liver peroxide experiment

March 8, 2012

The Liver: Helping Enzymes Help You!

A fun chemistry challenge from Science Buddies

By Science Buddies

Key concepts Chemistry Acids Bases Temperature Physiology Molecular biology

Introduction Your liver is important for cleaning up any potentially dangerous substances you consume. But how does it do it?—With a little help from some complex chemistry. Within your liver, as within every tissue in the body, many chemical reactions occur. Often these reactions require "help" to happen at a faster speed, and this can be supplied by enzymes—tiny types of proteins.

The liver uses specialized enzymes to help it break down toxic substances and make them safer for the body to process. But an enzyme, just like the chemical reactions it modifies, needs certain conditions to do its work. So, some environments can make a liver enzyme effective, whereas others can prevent it from working at all.

On supporting science journalism

If you're enjoying this article, consider supporting our award-winning journalism by subscribing . By purchasing a subscription you are helping to ensure the future of impactful stories about the discoveries and ideas shaping our world today.

Background A chemical reaction occurs when compounds come together and their molecules interact to form new compounds. Sometimes these reactions happen by themselves, are usually very fast and spontaneous, and give off energy. Other chemical reactions need energy, without which they would proceed very slowly or not at all. Enzymes can help speed up these types of chemical reactions.

Enzymes are large proteins that speed up the rate of a chemical reaction by acting as a catalyst. A catalyst provides the necessary environment for the reaction to occur, thereby quickening it. Certain catalysts work for certain kinds of reactions; in other words, each enzyme has a particular type of reaction that it can activate. Enzymes can be very fussy and sometimes need to be in certain environments or conditions to work well—or at all. Some enzymes can even be damaged, such as when exposed to too much heat. A damaged enzyme may no longer work to catalyze a chemical reaction.

Catalase is an enzyme in the liver that breaks down harmful hydrogen peroxide into oxygen and water. When this reaction occurs, oxygen gas bubbles escape and create foam. Materials • Raw liver (fresh or frozen, thawed; one quarter pound) • Knife • Cutting board • Blender • Water • Refrigerator • Medicine dropper • Large plate • Hydrogen peroxide (new or recently purchased bottle works best) • Measuring teaspoon • Two bowls • Vinegar • Baking soda • Microwave-safe bowl (with a cover) • Microwave oven Preparation • Completely disinfect any surface that the raw liver touches during this activity. • On the cutting board, carefully cut the liver into little, cube-shaped pieces, about one to two centimeters long. Be careful using the sharp knife. (An adult may need to help with this.) • Place the liver cubes into a blender and add an equal volume of water. Blend on high speed, pulsing when necessary, until the liver is smooth and no chunks are present. Be careful of the sharp blades in the blender. • Keep the blended liver in the refrigerator. Procedure • Put one drop of the blended liver on the large plate. To the blended liver drop, add one drop of hydrogen peroxide. You should see a lot of bubbles! What do you think the bubbles are made of? This shows that the liver enzyme catalase is working to start the chemical reaction that breaks down the hydrogen peroxide that would be harmful to the body into less dangerous compounds. • To test the effect of an acid on the liver enzyme, put one teaspoon of the blended liver in a bowl and mix it well with one teaspoon vinegar. What is the color and consistency of this mixture? Put one drop of the mixture on a clean part of the large plate and add one drop of hydrogen peroxide to it. Compared with the untreated blended liver, did more, less or about the same amount of bubbles form? Did they form more slowly, more quickly or at about the same rate? • To test the effect of a base, put one teaspoon of the blended liver in a bowl and mix it with one teaspoon baking soda. What is the color and consistency of this mixture? Put one drop of the mixture on a clean part of the large plate and add one drop of hydrogen peroxide to it. Did more, less or about the same amount of bubbles form? Did they form more slowly, more quickly or at about the same rate? • To test the effect of heat, put one teaspoon of the blended liver into a microwave-safe bowl. Cover the bowl and microwave it on high for 20 seconds. How does the blended liver look after heating? Remove a drop-size amount of the heated liver and put it on a clean part of the large plate. Add one drop of hydrogen peroxide to it. Did more, less or about the same amount of bubbles form? Did they form more slowly, more quickly or at about the same rate? • Based on your observations, under which condition(s) does it look like the enzyme works best? Which condition(s) makes it work the worst? Why do you think this is so? • Extra: Try experimenting with other conditions. For example, try freezing some blended liver or mixing it with salt and then test the enzyme's activity. Or you could try adding more than one teaspoon of vinegar or baking soda and then test the enzyme. Under which conditions does the enzyme work well, and under which ones does it work poorly? • Extra: You could try this activity again using another enzyme, called bromelain, which digests proteins and can be extracted from pineapples. One protein that is fun to digest using bromelain is gelatin, which is found in many puddings and gelatinous desserts. How do different conditions affect the ability of bromelain to digest proteins? Observations and results

When exposed to hydrogen peroxide, did the blended liver bubble less when mixed with either the vinegar or baking soda compared with when it was untreated? Did it bubble even less after it was microwaved?

An enzyme needs certain conditions to work, and the ideal environment can be a hint as to where the enzyme normally works in the body. And because different body tissues have distinct environments—acidic or warm—each enzyme is tuned to work best under specific conditions.

Different tissues in the body have different pHs (pH is a measure of how basic or acidic a solution is). The liver maintains a neutral pH (about pH 7), which is easiest for its enzymes, such as catalase, to work in. Consequently, when exposed to hydrogen peroxide the liver should have produced more bubbles (oxygen gas), and at a faster rate, when it was untreated than when exposed to vinegar or baking soda. (It may have bubbled more when treated with baking soda, compared with vinegar, because it might have been better able to return the pH to around 7.)

Similarly, enzymes in the liver are also used to functioning at body temperature (37 degrees Celsius), so microwaving the blended liver to a temperature hotter than that should have damaged the catalase enzyme and clearly decreased the amount of bubbles when it was exposed to hydrogen peroxide.

Cleanup Safely dispose of any raw liver meat used in this activity by putting it in the trash when you are done. Completely disinfect any surfaces that the raw liver meat touched during this activity, and be sure to thoroughly wash your hands with soap and warm water.

More to explore " Enzymes Make the World Go 'Round " from Rader's Chem4Kids.com " Your Liver " from KidsHealth " Catalase " from David Goodsell and RCSB Protein Data Bank " Liver Stinks! " from Science Buddies " Which Fruits Can Ruin Your Dessert? " from Science Buddies This activity brought to you in partnership with Science Buddies

Everyday teaching for everyday life

Enzyme Liver Lab

Measure the effects of changes in temperature, pH, and enzyme concentration on reaction rates of an enzyme catalyzed reaction in a controlled experiment.
Explain how environmental factors affect the rate of enzyme-catalyzed reactions.

INTRODUCTION: What would happen to your cells if they made a poisonous chemical? You might think that they would die. In fact, your cells are always making poisonous chemicals. They do not die because your cells use enzymes to break down these poisonous chemicals into harmless substances. Enzymes are proteins that speed up the rate of reactions that would otherwise happen more slowly. The enzyme is not altered by the reaction. You have hundreds of different enzymes in each of your cells.

Each of these enzymes is responsible for one particular reaction that occurs in the cell. In this lab, you will study an enzyme that is found in the cells of many living tissues. The name of the enzyme is catalase (KAT-uh-LAYSS); it speeds up a reaction which breaks down hydrogen peroxide, a toxic chemical, into 2 harmless substances–water and oxygen.

The reaction is: 2 H 2 O 2 —-> 2 H 2 O + O 2

This reaction is important to cells because hydrogen peroxide (H2O2) is produced as a byproduct of many normal cellular reactions. If the cells did not break down the hydrogen peroxide, they would be poisoned and die. In this lab, you will study the catalase found in liver cells. You will be using chicken or beef liver. It might seem strange to use dead cells to study the function of enzymes. This is possible because when a cell dies, the enzymes remain intact and active for several weeks, as long as the tissue is kept refrigerated.

MATERIALS: 13 test tubes, measuring pipette, acid, base, water, 10-ml graduated cylinder, 40 ml 3% Hydrogen peroxide solution, scissors and forceps (tweezers), fresh liver, apple, potato, yeast, ice bath, warm water bath, boiling water bath

PROCEDURE: Choose 1 team member to be the investigator and 1 to be the manager. The manager will be in charge of reading the directions and recording the data on the data table page. The investigator will follow the directions the manager reads. Both members are responsible for understanding what is happening and why.

There are questions in bold in the instructions. Be sure to answer those on your Data Table page.

PART A – Observe Normal Catalase Reaction

You should have a test tube rack with test tubes facing down. Clean test tubes are down, dirty are facing up.
Place 1 pipette (dropper) full of the 3% hydrogen peroxide (normal peroxide) solution into a clean test tube.
What gas is being produced in the reaction? (hint: look at the chemical equation above, which of the products is a gas)
This reaction from step 2 is the normal reaction, we say it reacted at a rate of 4 . This has been filled in for you. You will compare all the other reactions to this one. If it is faster, it will be a 5. If it is slower, it will be below 4.
The rate is how fast or slow the reaction goes. Not how many bubbles it produces! That is based on how much liver or peroxide there is.
Recall that a reaction that absorbs heat is endothermic; a reaction that gives off heat is exothermic. Now, feel the temperature of the test tube with your hand.
Has it gotten warmer or colder? Is the reaction endothermic or exothermic?
What is this liquid composed of? (hint: it is not liver juice)
What do you think would happen if you added more liver to this liquid?
Add another piece of liver to the liquid from the first reaction and record the reaction rate. (1 – 5). What happened? Why do you think this happened?
Is catalase reusable? Explain how you know .
Empty the contents of the test tubes into the “Waste” container. Put the test tubes facing up back in the test tube rack. Do not reuse the test tubes. We will wash all test tubes at the end of the lab.
Make sure everything on your Data Table Page for Part A is filled out before you move on to Part B.

PART B – What Tissues Contain Catalase

You will now test for the presence of catalase in tissues other than liver.

Get 3 clean test tubes, place 1 pipette-full of hydrogen peroxide in each.
Does potato contain catalase?
Does yeast contain catalase?
Does apple contain catalase?
Do some contain more catalase than others? How can you tell?
Empty the contents of all test tubes into the “Waste” container. Put the test tubes facing up back in the test tube rack. Do not reuse the test tubes. We will wash all test tubes at the end of the lab.
Make sure everything on your Data Table Page for Part B is filled out before you move on to Part C.

PART C – What is the Effect of Temperature on Catalase Activity?

Place the boiled liver in a test tube. Add 1 pipette-full of normal hydrogen peroxide. Record the reaction rate.
Get one test tube of cold liver and one of cold peroxide.
How did cold affect catalase function?
Get one test tube of warm liver and one of warm peroxide.
How did heat affect catalase function?
Make sure everything on your Data Table Page for Part D filled out before you move on to Part E.

PART D – What is the Effect of pH on Catalase Activity?

Add the piece of liver to the test tube and record the reaction rate.
Add the piece of liver to test tube and record the reaction rate.
Does there appear to be a pH that catalase works best at? What is it?
What is the effect of low pH (acid) on enzyme activity?
What is the effect of high pH (base) on enzyme activity?

Your browser is not supported

Sorry but it looks as if your browser is out of date. To get the best experience using our site we recommend that you upgrade or switch browsers.

Find a solution

Skip to main content
Skip to navigation

Back to parent navigation item
Primary teacher
Secondary/FE teacher
Early career or student teacher
Higher education
Curriculum support
Literacy in science teaching
Periodic table
Interactive periodic table
Climate change and sustainability
Resources shop
Collections
Remote teaching support
Starters for ten
Screen experiments
Assessment for learning
Microscale chemistry
Faces of chemistry
Classic chemistry experiments
Nuffield practical collection
Anecdotes for chemistry teachers
On this day in chemistry
Global experiments
PhET interactive simulations
Chemistry vignettes
Context and problem based learning
Journal of the month
Chemistry and art
Art analysis
Pigments and colours
Ancient art: today's technology
Psychology and art theory
Art and archaeology
Artists as chemists
The physics of restoration and conservation
Ancient Egyptian art
Ancient Greek art
Ancient Roman art
Classic chemistry demonstrations
In search of solutions
In search of more solutions
Creative problem-solving in chemistry
Solar spark
Chemistry for non-specialists
Health and safety in higher education
Analytical chemistry introductions
Exhibition chemistry
Introductory maths for higher education
Commercial skills for chemists
Kitchen chemistry
Journals how to guides
Chemistry in health
Chemistry in sport
Chemistry in your cupboard
Chocolate chemistry
Adnoddau addysgu cemeg Cymraeg
The chemistry of fireworks
Festive chemistry
Education in Chemistry
Teach Chemistry
On-demand online
Live online
Selected PD articles
PD for primary teachers
PD for secondary teachers
What we offer
Chartered Science Teacher (CSciTeach)
Teacher mentoring
UK Chemistry Olympiad
Who can enter?
How does it work?
Resources and past papers
Top of the Bench
Schools' Analyst
Regional support
Education coordinators
RSC Yusuf Hamied Inspirational Science Programme
RSC Education News
Supporting teacher training
Interest groups

A primary school child raises their hand in a classroom

More navigation items

Hydrogen peroxide decomposition using different catalysts

Four out of five
No comments

From fresh liver, to powdered manganese, create different catalysts to explore the effervescent world of hydrogen peroxide decomposition

Your shopping list might look strange, but this practical will be well worth it. Supporting student to understand reaction rates, catalysis, and enzymes.

This experiment should take 5 minutes.

Equipment

Eye protection
Measuring cylinders, 250 cm 3 , x1 for each catalyst
Large tray for spills
Hydrogen peroxide solution, 75 cm 3 ,100 vol
Powdered manganese(IV) oxide (manganese dioxide, MnO 2 ), 0.5 g
Lead(IV) oxide (lead dioxide, PbO 2 ), 0.5 g
iron(III) oxide (red iron oxide, Fe 2 O 3 ), 0.5 g
Potato, 1 cm 3
Liver, 1 cm 3

Health, safety and technical notes

Read our standard health and safety guidance .
Always wear eye protection.
Hydrogen peroxide is corrosive, see CLEAPSS Hazcard HC050 .
Manganese oxide is harmful if swallowed or inhaled, see CLEAPSS Hazcard HC060 .
Lead dioxide is a reproductive toxin, harmful if swallowed or inhaled, a Specific Target Organ Toxin and hazardous to the aquatic environment, see CLEAPSS Hazcard HC056 .
Avoid contact of the catalysts with aluminium and other metal powders, explosive reactions can occur.

Before the demonstration

Line up five 250 cm 3 measuring cylinders in a tray.
Add 75 cm 3 of water to the 75 cm 3 of 100 volume hydrogen peroxide solution to make 150 cm 3 of 50 volume solution.

The demonstration

Place about 1 cm 3 of washing up liquid into each of the measuring cylinders.
To each one add the amount of catalyst specified above.
Then add 25 cm 3 of 50 volume hydrogen peroxide solution to each cylinder. The addition of the catalyst to each cylinder should be done as nearly simultaneously as possible – using two assistants will help.
Start timing.
Foam will rise up the cylinders.
Time how long each foam takes to rise to the top (or other marked point) of the cylinder.
The foam from the first three cylinders will probably overflow considerably.
Place a glowing spill in the foam; it will re-light, confirming that the gas produced is oxygen.

The lead dioxide will probably be fastest, followed by manganese dioxide and liver. Potato will be much slower and the iron oxide will barely produce any foam. This order could be affected by the surface areas of the powders.

Some students may believe that the catalysts – especially the oxides – are reactants because hydrogen peroxide is not noticeably decomposing at room temperature.

The teacher could point out the venting cap on the peroxide bottle as an indication of continuous slow decomposition.

Alternatively, s/he could heat a little hydrogen peroxide in a conical flask with a bung and delivery tube, collect the gas over water in a test-tube and test it with a glowing spill to confirm that it is oxygen.

This shows that no other reactant is needed to decompose hydrogen peroxide.

NB: Simply heating 50 volume hydrogen peroxide in a test-tube will not succeed in demonstrating that oxygen is produced. The steam produced will tend to put out a glowing spill. Collecting the gas over water has the effect of condensing the steam. It is also possible to ‘cheat’ by dusting a beaker with a tiny, almost imperceptible, amount of manganese dioxide prior to the demonstration and pouring hydrogen peroxide into it. Bubbles of oxygen will be formed in the beaker.

The reaction is :

2H 2 O 2 (aq) → 2H 2 O(l) + O 2 (g)

This is catalysed by a variety of transition metal compounds and also by peroxidase enzymes found in many living things.

Repeat the experiment, but heat the liver and the potato pieces for about five minutes in boiling water before use.
There will be almost no catalytic effect, confirming that the catalyst in these cases is an enzyme that is denatured by heat.
Investigate the effect of using lumpy or powdered manganese dioxide.
The powdered oxide will be more effective because of its greater surface area.
Try using other metal oxides or iron filings as catalysts.
Animal blood may be used instead of liver if local regulations allow this.
One teacher suggested measuring the height of the foam over suitable time intervals and plotting a graph.

More resources

Add context and inspire your learners with our short career videos showing how chemistry is making a difference .

Hydrogen peroxide decomposition using different catalysts - teacher notes

Additional information.

This practical is part of our Classic Chemistry Demonstrations collection.

14-16 years
16-18 years
Demonstrations
Reactions and synthesis
Rates of reaction

Specification

Catalysts are substances that speed up chemical reactions but can be recovered chemically unchanged at the end of the reaction.
(d) catalysts as substances that increase the rate of a reaction while remaining chemically unchanged and that they work by lowering the energy required for a collision to be successful (details of energy profiles are not required)
(e) characteristics of a catalyst
2.3.2 suggest appropriate practical methods to measure the rate of a reaction and collect reliable data (methods limited to measuring a change in mass, gas volume or formation of a precipitate against time) for the reaction of: metals with dilute acid;…
2.3.2 suggest appropriate practical methods to measure the rate of a reaction and collect reliable data (methods limited to measuring a change in mass, gas volume or formation of a precipitate against time) for the reaction of: metals with dilute acid…
Rate of reaction.
(ii) catalysts.
Enzymes as catalysts produced by living cells (two examples).
WS.3.5 Interpreting observations and other data (presented in verbal, diagrammatic, graphical, symbolic or numerical form), including identifying patterns and trends, making inferences and drawing conclusions.
Catalysts change the rate of chemical reactions but are not used up during the reaction. Different reactions need different catalysts.
Enzymes act as catalysts in biological systems.
Factors which affect the rates of chemical reactions include: the concentrations of reactants in solution, the pressure of reacting gases, the surface area of solid reactants, the temperature and the presence of catalysts.
WS3.5 Interpreting observations and other data (presented in verbal, diagrammatic, graphical, symbolic or numerical form), including identifying patterns and trends, making inferences and drawing conclusions.
Recall that enzymes act as catalysts in biological systems.
Describe the characteristics of catalysts and their effect on rates of reaction.
3e Interpreting observations and other data (presented in verbal, diagrammatic, graphical, symbolic or numerical form), including identifying patterns and trends, making inferences and drawing conclusions
7.6 Describe a catalyst as a substance that speeds up the rate of a reaction without altering the products of the reaction, being itself unchanged chemically and in mass at the end of the reaction
7.8 Recall that enzymes are biological catalysts and that enzymes are used in the production of alcoholic drinks
IaS2.11 in a given context interpret observations and other data (presented in diagrammatic, graphical, symbolic or numerical form) to make inferences and to draw reasoned conclusions, using appropriate scientific vocabulary and terminology to communicat…
C6.2.4 describe the characteristics of catalysts and their effect on rates of reaction
C6.2.5 identify catalysts in reactions
C6.2.14 describe the use of enzymes as catalysts in biological systems and some industrial processes
C6.2.13 describe the use of enzymes as catalysts in biological systems and some industrial processes
WS.1.3e interpreting observations and other data
C5.1f describe the characteristics of catalysts and their effect on rates of reaction
C5.1i recall that enzymes act as catalysts in biological systems
C5.2f describe the characteristics of catalysts and their effect on rates of reaction
C5.2i recall that enzymes act as catalysts in biological systems

A diagram and graph showing how a reversible reaction reaches equilibrium

Help learners master equilibrium and reversible reactions

2024-06-24T06:59:00Z By Emma Owens

Use this poster, fact sheet and storyboard activity to ensure your 14–16 students understand dynamic equilibrium

A hand using scissor-handle tweezers to hold a piece of paper that is on fire but not burning

Non-burning paper: investigate the fire triangle and conditions for combustion

2024-06-10T05:00:00Z By Declan Fleming

Use this reworking of the classic non-burning £5 note demonstration to explore combustion with learners aged 11–16 years

A bottle of bromine water next to two test tubes - one contains only clear liquid and the other contains clear liquid sitting on an orange liquid

Everything you need to introduce alkenes

2024-06-04T08:22:00Z By Dan Beech

Help your 14–16 learners to master the fundamentals of the reactions of alkenes with these ideas and activities

No comments yet

Only registered users can comment on this article., more experiments.

Image showing a one page from the technician notes, teacher notes, student sheet and integrated instructions that make up this resource, plus two bags of chocolate coins

‘Gold’ coins on a microscale | 14–16 years

By Dorothy Warren and Sandrine Bouchelkia

Practical experiment where learners produce ‘gold’ coins by electroplating a copper coin with zinc, includes follow-up worksheet

Practical potions microscale | 11–14 years

By Kirsty Patterson

Observe chemical changes in this microscale experiment with a spooky twist.

An image showing the pages available in the downloads with a water bottle in the shape of a 6 in the foreground.

Antibacterial properties of the halogens | 14–18 years

By Kristy Turner

Use this practical to investigate how solutions of the halogens inhibit the growth of bacteria and which is most effective

Contributors
Email alerts

Site powered by Webvision Cloud

Practical Biology

A collection of experiments that demonstrate biological concepts and processes.

Observing earthworm locomotion

Practical Work for Learning

Published experiments

Investigating an enzyme-controlled reaction: catalase and hydrogen peroxide concentration, class practical or demonstration.

Hydrogen peroxide ( H 2 O 2 ) is a by-product of respiration and is made in all living cells. Hydrogen peroxide is harmful and must be removed as soon as it is produced in the cell. Cells make the enzyme catalase to remove hydrogen peroxide.

This investigation looks at the rate of oxygen production by the catalase in pureed potato as the concentration of hydrogen peroxide varies. The oxygen produced in 30 seconds is collected over water. Then the rate of reaction is calculated.

Lesson organisation

You could run this investigation as a demonstration at two different concentrations, or with groups of students each working with a different concentration of hydrogen peroxide. Individual students may then have time to gather repeat data. Groups of three could work to collect results for 5 different concentrations and rotate the roles of apparatus manipulator, result reader and scribe. Collating and comparing class results allows students to look for anomalous and inconsistent data.

Apparatus and Chemicals

For each group of students:.

Pneumatic trough/ plastic bowl/ access to suitable sink of water

Conical flask, 100 cm 3 , 2

Syringe (2 cm 3 ) to fit the second hole of the rubber bung, 1

Measuring cylinder, 100 cm 3 , 1

Measuring cylinder, 50 cm 3 , 1

Clamp stand, boss and clamp, 2

Stopclock/ stopwatch

For the class – set up by technician/ teacher:

Hydrogen peroxide, range of concentrations, 10 vol, 15 vol, 20 vol, 25 vol, and 30 vol, 2 cm 3 per group of each concentration ( Note 1 )

Pureed potato, fresh, in beaker with syringe to measure at least 20 cm 3 , 20 cm 3 per group per concentration of peroxide investigated ( Note 2 )

Rubber bung, 2-holed, to fit 100 cm 3 conical flasks – delivery tube in one hole (connected to 50 cm rubber tubing)

Health & Safety and Technical notes

Wear eye protection and cover clothing when handling hydrogen peroxide. Wash splashes of pureed potato or peroxide off the skin immediately. Be aware of pressure building up if reaction vessels become blocked. Take care inserting the bung in the conical flask – it needs to be a tight fit, so push and twist the bung in with care.

Read our standard health & safety guidance

1 Hydrogen peroxide: (See CLEAPSS Hazcard) Solutions less than 18 vol are LOW HAZARD. Solutions at concentrations of 18-28 vol are IRRITANT. Take care when removing the cap of the reagent bottle, as gas pressure may have built up inside. Dilute immediately before use and put in a clean brown bottle, because dilution also dilutes the decomposition inhibitor. Keep in brown bottles because hydrogen peroxide degrades faster in the light. Discard all unused solution. Do not return solution to stock bottles, because contaminants may cause decomposition and the stock bottle may explode after a time.

2 Pureed potato may irritate some people’s skin. Make fresh for each lesson, because catalase activity reduces noticeably over 2/3 hours. You might need to add water to make it less viscous and easier to use. Discs of potato react too slowly.

3 If the bubbles from the rubber tubing are too big, insert a glass pipette or glass tubing into the end of the rubber tube.

SAFETY: Wear eye protection and protect clothing from hydrogen peroxide. Rinse splashes of peroxide and pureed potato off the skin as quickly as possible.

Preparation

a Make just enough diluted hydrogen peroxide just before the lesson. Set out in brown bottles ( Note 1 ).

b Make pureed potato fresh for each lesson ( Note 2 ).

c Make up 2-holed bungs as described in apparatus list and in diagram.

Investigation

d Use the large syringe to measure 20 cm 3 pureed potato into the conical flask.

e Put the bung securely in the flask – twist and push carefully.

f Half-fill the trough, bowl or sink with water.

g Fill the 50 cm 3 measuring cylinder with water. Invert it over the trough of water, with the open end under the surface of the water in the bowl, and with the end of the rubber tubing in the measuring cylinder. Clamp in place.

h Measure 2 cm 3 of hydrogen peroxide into the 2 cm 3 syringe. Put the syringe in place in the bung of the flask, but do not push the plunger straight away.

i Check the rubber tube is safely in the measuring cylinder. Push the plunger on the syringe and immediately start the stopclock.

j After 30 seconds, note the volume of oxygen in the measuring cylinder in a suitable table of results. ( Note 3 .)

k Empty and rinse the conical flask. Measure another 20 cm 3 pureed potato into it. Reassemble the apparatus, refill the measuring cylinder, and repeat from g to j with another concentration of hydrogen peroxide. Use a 100 cm 3 measuring cylinder for concentrations of hydrogen peroxide over 20 vol.

l Calculate the rate of oxygen production in cm 3 /s.

m Plot a graph of rate of oxygen production against concentration of hydrogen peroxide.

The Biology Corner

Biology Teaching Resources

StoryLab: How Enzymes Work

This story lab aligns to an investigations students do with enzymes where they put hydrogen peroxide on liver and observe bubbles produced from the reaction with catalase.

This investigation has several versions for different levels of biology (regular track, intro, and AP) though the story lab was intended for the intro track students who do “ Investigation: How Do Enzymes Work? “

If students are unable to do the lab in class, they can complete this worksheet as an alternative. Obviously, the lab experience is preferred, but there are some cases, such as chronic absenteeism or students who are home-schooled, who do not have access to the lab.

Time Required: 15-20 minutes Grade Level: 8-12

Other Resources on Enzymes

Enzymes – Analyzing Graphics

Investigation – How Do Enzymes Work

Shannan Muskopf

Top 7 Science Experiments with Hydrogen Peroxide

Welcome to our carefully curated collection of hydrogen peroxide science experiments. This roundup invites you to journey through experiments showing you this simple compound’s versatile nature.

Hydrogen peroxide is a common household item known for its antiseptic properties. Yet, beneath its seemingly mundane identity lies a treasure trove of chemical wonders waiting to be explored. With its reactive nature and ability to break down into simpler molecules, hydrogen peroxide is a captivating subject for many scientific experiments.

Note : Students should know the concentration of hydrogen peroxide and understand its potential hazards. These experiments should be conducted in a controlled manner, adhering to the provided procedure and under the supervision of an adult.

1. Elephant Toothpaste

One experiment that is sure to captivate the minds of both students and teachers alike is the famous “Elephant Toothpaste” experiment using hydrogen peroxide.

Elephant Toothpaste experiment is a must-try for any classroom, sparking excitement and curiosity while reinforcing fundamental chemistry principles.

2. Genie in a Bottle

This experiment is an absolute must-try for students, as it offers a hands-on journey into the world of chemical reactions.

By delving into “Genie in a Bottle,” you’ll unleash your curiosity, hone critical thinking skills, and witness the power of chemistry firsthand.

3. DIY Pasta Rocket Engine

The DIY Pasta Rocket Engine experiment using hydrogen peroxide (H2O2) is a captivating and exciting activity that students and teachers should definitely try.

This experiment provides an excellent opportunity for students to explore the principles of chemical reactions, combustion, and propulsion in a hands-on and engaging manner.

4. Remove Stains Using Hydrogen Peroxide

Learning how to remove stains using hydrogen peroxide is a practical and useful experiment that both students and teachers should try. Hydrogen peroxide possesses excellent stain-removing properties due to its oxidizing nature, making it a valuable tool for tackling a wide range of stains.

5. Flame Light Relight – Science Magic

The Flame Light Relight experiment is an intriguing and educational experience that students and teachers should approach with caution.

By engaging in the Flame Light Relight experiment responsibly, students can gain a deeper understanding of the science behind fire and chemical reactions while reinforcing the importance of safety measures and responsible experimentation.

Learn more: Flame Light Relight

6. Potato Catalyzed H2O2 Decomposition

The Potato Catalyzed H2O2 Decomposition experiment is a fascinating and educational activity that students and teachers should definitely try. In this experiment, the natural enzymes present in a potato act as a catalyst to accelerate the decomposition of hydrogen peroxide.

7. Boiled Versus Fresh Liver with Hydrogen Peroxide

The Boiled Versus Fresh Liver with Hydrogen Peroxide experiment is a captivating and informative activity that students and teachers should consider trying.

By comparing the reaction of hydrogen peroxide with boiled and fresh liver, students can explore the effects of heat on enzymatic activity.

Navigating By Joy

Learning, laughing and loving together, enzyme science fun – inflate a balloon with liver & hydrogen peroxide.

Last week Cordie thought up a fun liver and hydrogen peroxide enzyme experiment. The idea is an interesting extension of elephant toothpaste . And it extends the chemistry learning into biology (useful for homeschool records).

When we make elephant toothpaste we use yeast as a catalyst in the breakdown of hydrogen peroxide into water and oxygen gas. By adding soap and food dye, we get oodles of colourful foam that make for a fun and memorable science lesson.

Cordie recently discovered that liver also contains a catalyst which breaks down hydrogen peroxide. She decided to try to inflate a balloon with the gas produced and to test it for oxygen. (Is it just my kids that love experiments where they get to play with fire?)

You can watch Cordie demonstrating her experiment in the video [4:39] below (with crumpet cameo from Jasper).

What you need

Liver (we used about 200g)

Hydrogen peroxide (we used about 75ml / 1/3 cup of 9% / 30 vol)

Small plastic water bottle

Peg or clip

If you want to test for oxygen you’ll also need:

Splint (thin piece of wood)

Lighter/matches

What you do

1. Chop the liver and put it into the bottle

2. Pour the hydrogen peroxide into the balloon via the funnel

3. Carefully put the neck of the balloon over the bottle so that the hydrogen peroxide pours onto the liver

4. Hold the balloon in place as it inflates with gas, then clip it closed

5. If you want to test the gas, light the splint then extinguish the flame. Immediately insert the still-glowing splint into the bottle

What happens

As soon as the hydrogen peroxide touches the liver, foam appears and the bottle gets warm. After a few seconds the balloon begins to inflate.

When you lower the glowing splint into the bottle, the flame rekindles. (My kids’ favourite bit!) There should be enough oxygen to do this over and over again.

What’s happening?

Just as with elephant toothpaste, the hydrogen peroxide is broken down into water and oxygen in the presence of a catalyst. (A catalyst speeds up chemical reactions without being changed itself.) The reaction is exothermic – it produces heat.

2H 2 O 2 —-> 2H 2 O + O 2

Liver contains a biological catalyst, the enzyme catalase.

Just as the liver in our experiment breaks down a poisonous chemical into harmless substances, an animal’s liver breaks down toxins and renders them harmless.

Take it further

Heat and cold affect how enzymes work. In Cordie’s science class she timed her experiments using boiled and frozen liver alongside liver at room temperature.

Further resources

BBC Bitesize – Webpage and video about liver, hydrogen peroxide and enzymes

How to make elephant toothpaste

Do let me know if you try this. I love hearing from you. 🙂

If you liked this experiment I’d love you to share it on Facebook or Pinterest. For more about how we homeschool, subscribe to my YouTube channel or like Navigating By Joy on Facebook .

I’m appreciatively linking up with Weird Unsocialized Homeschoolers .

20 thoughts on “ Enzyme Science Fun – Inflate a Balloon With Liver & Hydrogen Peroxide ”

This is fantastic! !

Thanks, Phyllis!

I’m gonna confess, I would not have thought of doing this at all. Very cool.

Me neither, Ticia. It’s very cool when kids start setting up their own experiments, isn’t it?

I am sorry, but you lost me at liver. :p

And what are you feeding Cordie … wow she has sprung up and looks so much more mature … I think you notice it with the girls more so. Mine are so different these days.

I know! I think she’s going to get taller than my 1.73m this year. I’m already wearing her cast offs.?

LOL, Lisa. Yeah it was a rather yucky one!

I have no idea what it all meant (I have the least scientific brain in the world) but it was very impressive!

LOL, Lucy! Thanks. 🙂

This was super impressive! I think we may need to try this.

I love how it demonstrates how a liver can detoxify something. Fabulous!

Thanks, M. It’s very cool, isn’t it? 🙂

A great experiment! Love the hands-on learning!

Gotta love the video instruction! Easy project to do.

Thanks for reading and commenting, Nita. Yes it was surprisingly easy, if a little icky!

So cool! Tell Cordie I was very impressed with her experiment and loved being able to watch the video showing how she did it. I plan to show my three youngest (12, 9, and 7); I’m sure they’ll want to recreate this!

Thanks, Marla. I’ll tell Cordie. 🙂 Let me know how it goes if your children try it!

Hi thanks for this liver h202 experiment, i substituted the liver for raw potatoes. The reaction did inflate the balloon on top of the bottle. But when I lit a splint e.g. a pencil and extinguished it, but still having a glow, i was unable to relight the pencil after placing it in the bottle.

Do you have any suggestions why this didn’t work for me?

THE DECOMPOSITION OF HYDROGEN PEROXIDE BY LIVER CATALASE

1. The velocity of decomposition of hydrogen peroxide by catalase as a function of ( a ) concentration of catalase, ( b ) concentration of hydrogen peroxide, ( c ) hydrogen ion concentration, ( d ) temperature has been studied in an attempt to correlate these variables as far as possible. It is concluded that the reaction involves primarily adsorption of hydrogen peroxide at the catalase surface. 2. The decomposition of hydrogen peroxide by catalase is regarded as involving two reactions, namely, the catalytic decomposition of hydrogen peroxide, which is a maximum at the optimum pH 6.8 to 7.0, and the "induced inactivation" of catalase by the "nascent" oxygen produced by the hydrogen peroxide and still adhering to the catalase surface. This differs from the more generally accepted view, namely that the induced inactivation is due to the H 2 O 2 itself. On the basis of the above view, a new interpretation is given to the equation of Yamasaki and the connection between the equations of Yamasaki and of Northrop is pointed out. It is shown that the velocity of induced inactivation is a minimum at the pH which is optimal for the decomposition of hydrogen peroxide. 3. The critical increment of the catalytic decomposition of hydrogen peroxide by catalase is of the order 3000 calories. The critical increment of induced inactivation is low in dilute hydrogen peroxide solutions but increases to a value of 30,000 calories in concentrated solutions of peroxide.

The Full Text of this article is available as a PDF (1.1M).

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

Dixon M. Studies on Xanthine Oxidase: The Function of Catalase. Biochem J. 1925; 19 (3):507–512. [ PMC free article ] [ PubMed ] [ Google Scholar ]
Evans CA. On the Catalytic Decomposition of Hydrogen Peroxide by the Catalase of Blood. Biochem J. 1907; 2 (4):133–155. [ PMC free article ] [ PubMed ] [ Google Scholar ]
Eadie GS. The Effect of Substrate Concentration on the Hydrolysis of Starch by the Amylase of Germinated Barley. Biochem J. 1926; 20 (5):1016–1023. [ PMC free article ] [ PubMed ] [ Google Scholar ]

FREE K-12 standards-aligned STEM

curriculum for educators everywhere!

Find more at TeachEngineering.org .

TeachEngineering
Living with Your Liver

Hands-on Activity Living with Your Liver

Grade Level: 6 (5-7)

Time Required: 45 minutes

Expendable Cost/Group: US $6.00

Group Size: 2

Activity Dependency: None

Subject Areas: Biology, Life Science

NGSS Performance Expectations:

Curriculum in this Unit Units serve as guides to a particular content or subject area. Nested under units are lessons (in purple) and hands-on activities (in blue). Note that not all lessons and activities will exist under a unit, and instead may exist as "standalone" curriculum.

Prosthetic Party: Build and Test Replacement Legs
Sticks and Stones Will Break That Bone!
The Artificial Bicep
Measuring Our Muscles
Clearing a Path to the Heart
Polluted Air = Polluted Lungs
Protect That Pill
Sounds All Around
Protect Those Eyes
You're the Expert
DNA Profiling & CODIS: Who Robbed the Bank?
Repairing Broken Bones

Unit

Lesson

Activity

TE Newsletter

Engineering connection, learning objectives, materials list, worksheets and attachments, more curriculum like this, pre-req knowledge, introduction/motivation, vocabulary/definitions, troubleshooting tips, activity extensions, activity scaling, user comments & tips.

Tissue and organ regeneration is one of the most cutting-edge engineering applications, and an area of significant engineering research. In labs across the world, mechanical and biomedical engineers are exploring and experimenting with how to "grow" artificial ligaments, organs, skin and spinal disks. Since human livers are able to regenerate, bioengineers can create new and functional organs using only a portion of another liver. In the future, instead of waiting for liver donations that match patients' blood types, hospitals may supply patients who have liver failure with whole liver organs ready for surgical replacement.

After this activity, students should be able to:

Explain how different salt concentrations affect the liver's ability to break down toxins.
Explain that the liver is the only internal organ that can currently be regenerated by biomedical engineers.
Explain why tissue regeneration by biomedical engineers is important to human health.

Educational Standards Each TeachEngineering lesson or activity is correlated to one or more K-12 science, technology, engineering or math (STEM) educational standards. All 100,000+ K-12 STEM standards covered in TeachEngineering are collected, maintained and packaged by the Achievement Standards Network (ASN) , a project of D2L (www.achievementstandards.org). In the ASN, standards are hierarchically structured: first by source; e.g. , by state; within source by type; e.g. , science or mathematics; within type by subtype, then by grade, etc .

Ngss: next generation science standards - science.

NGSS Performance Expectation
MS-PS1-2. Analyze and interpret data on the properties of substances before and after the substances interact to determine if a chemical reaction has occurred. (Grades 6 - 8) Do you agree with this alignment? Thanks for your feedback!


This activity focuses on the following aspects of NGSS:
Science & Engineering Practices	Disciplinary Core Ideas	Crosscutting Concepts
Analyze and interpret data to determine similarities and differences in findings. Alignment agreement: Thanks for your feedback! Science knowledge is based upon logical and conceptual connections between evidence and explanations. Alignment agreement: Thanks for your feedback!	Each pure substance has characteristic physical and chemical properties (for any bulk quantity under given conditions) that can be used to identify it. Alignment agreement: Thanks for your feedback! Substances react chemically in characteristic ways. In a chemical process, the atoms that make up the original substances are regrouped into different molecules, and these new substances have different properties from those of the reactants. Alignment agreement: Thanks for your feedback!

Common Core State Standards - Math

View aligned curriculum

Do you agree with this alignment? Thanks for your feedback!

International Technology and Engineering Educators Association - Technology

State standards, colorado - math, colorado - science.

Each group needs:

3 test tubes
2 eye droppers (for salt solution and hydrogen peroxide)
Stopwatch or timer
2 small plastic or glass containers to hold the salt solution and hydrogen peroxide (such as baby food jars; no lids required)
Living with Your Liver Worksheet , one per student
(optional) 3 12-inch (.3 m) balloons (see Troubleshooting Tips section)

Photo shows reddish-brown meat wrapped in plastic wrap.

For the entire class to share:

Liver solution: In a blender, blend 1/4 pound (113 g) of diced fresh beef liver with 13.5 fluid ounces (104 ml) water. Keep the liver solution refrigerated until 20 minutes before the activity. Do not allow the mixture to be kept at room temperature.
1 eye dropper (for dropping liver solution into test tubes)
2% salt solution: Mix 0.07 ounces (2 g) of salt with 6.8 fluid ounces (200 ml) of tap water
3% hydrogen peroxide (H 2 O 2 ; available at pharmacy or grocery store)
(optional) Masking tape and markers (to label small jars and test tubes)

Students should know that the liver is the largest internal organ in the human body and understand that its function is to remove wastes and toxins, and store vitamins.

The liver is the largest internal human organ and is essential for human life. Your liver is located on the right side of your body beneath the diaphragm, which is just beneath your lungs. Feel the lower ribs on the right side of your body — your liver is just on the other side of those ribs! Most adults have a liver weighing 3 to 3.5 pounds (1.4 to 1.6 kg) — this weighs about the same as four cans of soda! Also, the liver takes up a lot of space — adult livers are about the size of a football!

The liver is the most important organ involved in production and storage of biochemicals. This organ detoxifies the body, removes bacteria and stores a lot of vitamins. Sometimes the liver is exposed to toxins for so long that it cannot perform its job. This is the case with cirrhosis, which can be caused by drinking too much alcohol for a decade or more. After encountering too many toxins for too long, the liver can slowly die. Sodium (salt) decreases the liver's ability to break down harmful toxins, such as hydrogen peroxide, which can be present in the body as a natural byproduct of cellular detoxification of other materials. Some studies link high-sodium diets to high blood pressure and heart disease.

By removing wastes (unneeded chemicals) and toxins, and storing vitamins, the liver helps us stay healthy. Sometimes, however, liver tissue is damaged and can die. Diseases such as alcoholism and Hepatitis C, for example, can cause serious liver damage. In severe cases, liver transplantation surgery may be necessary.

Tissue engineering is an area of research that combines engineering with life science. Tissue and organ regeneration is an area of significant engineering research. In labs across the world, mechanical and biomedical engineers are exploring and experimenting with how to "grow" artificial ligaments, organs, skin and spinal disks. Engineers study materials and artificial systems that can substitute for or strengthen damaged organ tissue in an organism. Tissue engineering involves the use of living cells in combination with an artificial support structure. Some materials used for support structures might include collagen or specialized polyesters. It is important for engineers to think about the different constraints that affect the choice of materials they use for tissue engineering. Can you think of some things that engineers might need to consider? Some material characteristics to consider might include replacement tissue size, material cell size, support structure size, rate of diffusion and degradation (how fast the material breaks down) within the human body.

The liver is one of the few human organs that can be regenerated. This means that in a lab we can generate an entirely new liver by using just a portion of a liver. In fact, using as little as one-quarter of an original liver is enough to create a whole new organ. Can you think of reasons why regenerating new organs may be useful? In the future, patients who suffer from liver failure may not need to wait for liver donations that match their blood types. Instead, hospitals may have functioning organs available ready to use! So you can see that it is important to understand the function of the liver if engineers are going to be successful in helping to protect and repair this vital human organ.

Background Information

The liver's function is to process and remove waste and toxins. One of the cellular organelles, called peroxisomes, is responsible for detoxifying waste products or foreign toxins within the cell. Peroxisome naturally produces hydrogen peroxide (H 2 O 2 ) during this detoxification process. If this hydrogen peroxide were allowed to build up, it would be harmful to the body. Found abundantly in the liver cells is an enzyme responsible for decomposing the H 2 O 2 into harmless reagents, water (H 2 O) and oxygen (O 2 ).

When encountering hydrogen peroxide, liver cells chemically break it into water and oxygen gas (2 H 2 O 2 >> 2 H 2 O + O 2 ). Because this reaction releases gas (which we know is oxygen because it is the only gaseous byproduct of the reaction), we can conclude that the liver solution is breaking down the hydrogen peroxide -- and is performing its job! When we add salt (and the same amount of hydrogen peroxide), however, the reaction gives off less gas (produces less oxygen). Therefore, the liver cells are less successful in breaking down the hydrogen peroxide; hence, the liver performs its job less effectively when salt is present.

Before the Activity

Prepare the liver solution.
Using the eye droppers, place 15 drops of the prepared liver solution into the test tubes. Make enough for each group to have three test tubes with 15 drops of the liver solution in each.
Prepare the salt solution.
Divide the prepared salt solution into smaller containers to distribute. Provide each group with one container of salt solution. Label the salt solution so it is not confused with the hydrogen peroxide.
Divide the hydrogen peroxide into smaller containers to distribute. Provide each group with one container of hydrogen peroxide. Label the hydrogen peroxide so it is not confused with the salt solution.
Make copies of the Living with Your Liver Worksheet , one per student.

Photo shows a man in a white button jacket holding a reddish-brown slab of meat that is the size of a small briefcase.

With the Students

Review the functions of the liver with students. Explain that hydrogen peroxide (H 2 O 2 ) is a toxin that the liver breaks down to remove it from the body. Hydrogen peroxide can be present in the body as a natural byproduct of cellular detoxification of other materials. Be sure students understand that this reaction produces bubbles as the toxin is altered into other substances.
Divide the class into teams of two students each. Distribute materials to each group (test tube with 15 drops of liver solution, salt solution, hydrogen peroxide, eye droppers and worksheets).
Have each group decide how many drops of salt solution (between 0 and 30) they will add to each test tube. Remind the students that a wider range provides more interesting results. (Optional: Use tape and markers to identify how many drops will be placed in each test tube.)
Tell students to add their specified number of drops of salt solution to each test tube of liver solution. Remind students to record these values on their worksheets.
With timers ready, have students add 15 drops of hydrogen peroxide to one of their test tubes. Add the drops relatively quickly. Have students time how long it takes the liver solution to react. Remind students to record their observations about this reaction.
Repeat step 4 for the second test tube. Remind students to compare and note the differences between this reaction and the previous.
Repeat step 4 for the third test tube. Remind students to compare and note the differences between this reaction and the previous two.
Have students finish the activity by completing the worksheet questions. (Optional: Have students graph their data results on the back of their worksheets, comparing number of salt drops versus time of reaction. See post-activity assessment on graphing in the Assessment section.)
Conclude by leading students in a discussion drawn from their worksheet answers, as well as post-activity questions and answers provided in the Assessment section.

bioengineering: The use of artificial tissues, organs or organ components to replace damaged or absent parts of the body, such as artificial limbs, and heart pacemakers. Bioengineering combines biology and engineering.

biomedical engineer: An engineer who works closely with biologists and medical doctors to develop medical instruments, artificial organs, and prosthetic devices.

biomedical engineering: The application of engineering techniques to the understanding of biological systems and the development of therapeutic technologies and devices. Kidney dialysis, pacemakers, synthetic skin and organs, artificial joints, and prostheses are some products of biomedical engineering. Also called bioengineering.

cirrhosis: A chronic disease of the liver characterized by the replacement of normal tissue with scar tissue and the loss of functional liver cells. It is most commonly caused by chronic alcohol abuse, but can also result from nutritional deprivation or infection, especially by the hepatitis virus.

collagen: A type of protein found in cells, which forms fibers and is very strong in tension.

constraint: A limitation or restriction. For engineers, constraints are the limitations and requirements that must be considered when designing a workable solution to a problem.

liver: A large glandular organ in the abdomen of vertebrate animals that is essential to many metabolic processes. The liver secretes bile, stores fat and sugar as reserve energy sources, converts harmful substances to less toxic forms, and regulates the amount of blood in the body.

organelles: The "little organs" inside our bodies' cells. Examples cell membrane, cell wall, ribosomes, nucleus, mitochondria, ribosomes, endoplasmic reticulum, golgi apparatus and lysosomes.

polyester: A type of polymer made of natural and synthetic chemicals. Used to make fabric, pillow stuffing, seatbelts, or a strengthener for damaged tissue.

regeneration: The ability to grow or replace lost or damaged tissue.

toxin: A substance that is poisonous to the body. Can be products or byproducts of ordinary metabolism (wastes) that are not broken down or excreted before building up to dangerous levels in the body.

Pre-Activity Assessment

Prediction : Have students predict the outcome of the activity before the activity is performed.

What will happen to the liver's ability to function (break down hydrogen peroxide) when salt is added to the liver?

Question/Answer : Ask students questions and have them raise their hands to answer.

What function does the liver perform? (Answer: The liver is responsible for removing waste materials and toxins, and storing vitamins in the human body.)
Biomedical engineers have determined that the liver is one of the few organs that can be regenerated. What does this mean? (Answer: Regeneration is the ability to re-grow lost or damaged cells.)
What might happen if a liver stops functioning? (Answer: If a liver stops functioning properly or encounters too many toxins it can die. In this case, a person needs a liver transplant to help his/her body regulate the wastes and toxins, and acquire essential vitamins.)

Activity Embedded Assessment

Worksheet : Have students complete the Living with Your Liver Worksheet . Review their data table and answers to gauge their understanding of the concepts.

Post-Activity Assessment

Graphing : Have students graph their results on the back of their worksheets, comparing number of salt drops versus time of reaction. How does the amount of salt affect the rate of reaction? Based on the graph, what would happen to the rate of reaction if you added more salt? Less salt?

Class Discussion : Have students raise their hands to share their answers to the worksheet questions. Talk about how salt affects the liver's ability to break down the toxin hydrogen peroxide. (Point to make: When salt was added to the liver, its ability to function [break down the hydrogen peroxide] was reduced.) Ask students to give advice to someone who has a very high salt content in his/her diet. (Example advice: Because a diet high in salt reduces the liver's ability to break down toxins, it is important to consume moderate amounts of salty foods). Point out that excessive alcohol can cause similar harmful effects to the liver's ability to break down toxins. Ask students to think about how salt might affect a biomedical engineer's development of tissue replacement processes. (Possible examples: Biomedical engineers may want to develop liver tissue that can withstand high salt content.) What types of things might an engineer need to consider when developing replacement liver tissue for a person with high salt content in their environment? (Possible considerations: Material characteristics such as replacement tissue size, material cell size, support structure size, rate of diffusion and degradation [how fast the material breaks down] within the human body.)

Safety Issues

Although 3% hydrogen peroxide is relatively innocuous, it is important to follow basic safety precautions when handling chemicals. Use the hydrogen peroxide in a well-ventilated area; concentrated fumes may irritate the sinuses and eyes. Be careful to keep hydrogen peroxide away from the eyes and mouth. Also avoid contact with clothing.
It is safe to dispose of liver, liver solution, salt solution, and hydrogen peroxide down the lab sink drain. Rinse the sink area well with warm water and soap to avoid odors. Alternatively, pour these items into a container (such as a glass jar or plastic bottle) and dispose in a trash receptacle.

If the difference between reaction rates is difficult to discern, try placing a standard 12-inch balloon over the test tube after adding the hydrogen peroxide. The gas produced by the chemical reactions fills the balloon. For the lower salt content solutions, the balloon should expand more than for the higher salt content solutions.

Have students research liver regeneration. What is liver generation? In what ways do engineers think it may help people?

Have students research the range of different materials used in tissue engineering. What are the latest developments in tissue engineering?

Have student research why tissue culture is important in tissue engineering. What types of specification might a tissue culture have? What types of devices do engineers design to aid in tissue cultures?

What other engineering innovations help people with liver problems? Direct students to research liver dialysis and bioartificial livers. How do they work?

For lower grades, conduct the experiment as a classroom demonstration. Have students sit close enough to observe the differences between the tests. Use the Living with Your Liver Worksheet (for Lower Grades) .
For upper grades, have students research the technology of organ regeneration to develop an understanding of what organ regeneration is and what engineers are doing to evolve this technology. Require students to turn in a one-page summary of what they learned.

This lesson helps students explore the functions of the kidney and its place in the urinary system. Students learn how engineers design instruments to help people when kidneys are not functioning properly or when environmental conditions change, such as kidney function in space.

preview of 'Just Passing Through' Lesson

Bio/Biomedical Engineering. The Engineering Alphabet, ASEE Engineering K12Center, American Society for Engineering Education. egfi-k12.org Accessed July 16, 2008.

Bioengineering. 2008. The Oxford Pocket Dictionary of Current English. www.encyclopedia.com Accessed July 16, 2008.

Cirrhosis. Dictionary.com. The American Heritage Dictionary of the English Language, Fourth Edition. Houghton Mifflin Company, 2004. dictionary.reference.com Accessed July 16, 2008.

Liver. Dictionary.com. The American Heritage Dictionary of the English Language, Fourth Edition. Houghton Mifflin Company, 2004. dictionary.reference.com Accessed July 16, 2008.

Contributors

Supporting program, acknowledgements.

The contents of this digital library curriculum were developed under a grant from the Fund for the Improvement of Postsecondary Education (FIPSE), U.S. Department of Education and National Science Foundation GK-12 grant no. 0338326. However, these contents do not necessarily represent the policies of the Department of Education or National Science Foundation, and you should not assume endorsement by the federal government.

Last modified: April 20, 2019

TOP CATEGORIES
AS and A Level
University Degree
International Baccalaureate
Uncategorised
5 Star Essays
Study Tools
Study Guides
Meet the Team
Molecules & Cells

Liver and Hydrogen Peroxide experiment

Aim: To see how different concentrations of hydrogen peroxide affects the enzyme activity and rate of reaction.

Hypothesis: I believe that when the concentration of the substrate (hydrogen peroxide) increases this will cause the rate of reaction to increase.

I believe this because enzyme activity and substrate concentration affect the rate of reaction. As the concentration of enzymes increase so does the number of active sites. If there is excess substrates present. This will then cause the rate of reaction to increase in the proportion of excess substrate molecules and enzymes. The rate of reaction depends on the rate of formation of enzyme – substrate complexes.

As the substrate concentration increases the rate of reaction will increase until all enzyme molecules are being used up. After this point it doesn’t matter how much more substrate you add the rate of reaction will not increase anymore as the enzymes are working as fast as they can to break down the substrate. The rate reaches maximum velocity and remains constant. Basically with the highest concentration the enzymes will be able to collide with more substrate molecules.

Here are 2 graphs to show the increase of rate of reaction as enzyme and substrate concentration increase. For the purpose of this experiment the enzyme concentration will be kept constant and the variable will be the substrate concentration.

1dm 3 10% Hydrogen peroxide – This is my substrate which I will make 6 different concentrations from.

Liver (Catalase) – This is my enzyme that will be used to break down the H 2 O 2

5x Test tubes with bungs and delivery tubes – Will be where the liver and hydrogen peroxide will react.

Gas syringe – Where the gas will be collected to measure the rate of reaction.

6x 250cm 3 Glass beakers – Where my 6 different concentrations will be stored.

6x Glass measuring cylinders – Will be used to measure out the 6 concentrations to a good degree of accuracy.

Thermometer – Used to try to keep temperature constant.

Pestle and mortar – Will be used to grind liver up to keep surface area constant.

Sand – Will grind liver up easily.

Stop watch – Will measure the time taken for the liver to break down the H 2 O 2. To a good degree of accuracy.

Knife – Used to cut liver into small pieces.

White Tile – Where liver will be cut on.

This is a preview of the whole essay

Balance – Will weigh the liver to 2 decimal places more accuracy.

Syringe 10cm 3 – Will be used to input the hydrogen peroxide into the test tube. Also measure the H 2 O 2 to a good degree of accuracy.

For the experiment I will choose 6 different concentrations and do the experiment 3 times with each one. My variable is the concentration of the substrate which is the hydrogen peroxide. Reason for choosing this variable is because enzymes are affected by the concentration of the substrate. My concentrations will be:

The water and hydrogen peroxide will always make up 10 Cm 3 .

6 Concentrations I feel is more than enough to see how it affects the rate of reaction.

I choose these concentrations as the concentrations lower then these took a bit of time to get the reaction started. This was when I was doing some preliminary results.

Preliminary:

For the preliminary I choose the highest and lowest concentration so straight away I could get an idea of how the substrate concentration affects the rate of reaction.

Highest: 10 Cm 3 Hydrogen peroxide.

Lowest: 5 Cm 3 Water 5 Cm 3 Hydrogen Peroxide

Preliminary results:

From this you can see that the highest concentration was quickest to react.

Put on protective clothing such as safety goggles, lab coat and gloves. First I will set up equipment appropriate as shown in the diagram. Using the knife I will cut the liver into small pieces on the white tile. After this has been done, I will weigh the liver on the balance to a weight of 2.00g. Next the liver will be placed in the pestle with some sand. Using the mortar I will grind the liver into smaller pieces. After this the liver will be transferred into a test tube. This will then be put into a test tube rack.

After I will then make my 6 concentrations. I will start off with my highest concentration which is 10% Hydrogen peroxide (10 Cm3). To make the other concentrations for instance my lowest add 5 Cm3 of hydrogen peroxide and the 5 Cm3 of water etc. Using the syringe I will collect my first concentration which will be the 10cm3 hydrogen peroxide (Highest). After the syringe will be placed onto the bung. The hydrogen peroxide can be inserted into the test tube with the liver when ready.

The liver needs to be at the bottom of the test tube. If not liver may be left un-reacted therefore it will not be a very precise test. An effected way is to use tweezers when placing the liver in the test tube. Next place the bung on top off the test tube. Make sure rubber tube is connected to the bung and gas syringe. After keep stop watch ready in one hand and then insert hydrogen peroxide from the syringe into the test tube. As soon as this has been done start the stop watch.

When the hydrogen peroxide is being broken down by the liver (catalase) oxygen is given off. The gas syringe volume will move up. When the syringe has stopped this is a signal to stop the stop watch. The time on the stop watch will be recorded in my table of results. The experiment needs to be done 3 times for each concentration.

Safety Precautions:

When using hydrogen peroxide safety precautions should be taken.

It is extremely corrosive which can cause severe burns and vapour can be irritating.

Goggles and safety clothing should be worn.
Gloves worn
If spilt clean up
If spilt on clothing change clothing
And the knife

When experiment is redone:

Pestle and mortar need to be cleaned out because more catalase will speed up the reaction. Test tubes need cleaning out. Also the syringe needs cleaning out. These factors may cause inaccuracies if not followed. More catalase means more active sites so therefore rate of reaction will increase. I will need to keep the ph and the temperature the same.

Overall the reliability of my results is pretty reliable. However there is an anomalous in the 8 Cm 3 concentrations as it is a lower value than the previous concentration. Other anomalous is the 1 st time for the 10 Cm 3 Hydrogen peroxide. This is a slight error with the timing. However you can still see a trend in the results. Precision is good. I worked out the average time by adding up all the 3 different times for each concentration and then dividing by 3. The limitations were that when the gas of oxygen being produced was inconsistent there for anomalies could have been down to this.

My results show a trend that as concentration increases so does the rate of reaction. The reaction is speeded up due to this. The 10 Cm 3 concentration was broken down fastest due to all the enzyme active site being used therefore the enzymes are working at fastest rate. To also explain this, the higher the concentration the more collisions there were between the enzyme molecules and the substrate molecules. As concentration goes up so do the active sites.

The anomalous results could have been down to the equipment not being cleaned properly after each experiment. The equipment may have contained extra catalase therefore this will increase the number of active site for the enzymes causing the hydrogen peroxide being broken down quicker. Another factor was that the room temperature rose as the day went on. It was cool in the morning and then got hotter.

Temperature affects the enzymes and substrate by causing the molecules to move faster. This causes the molecules to collide more often. And therefore the rate of reaction was increased. This could be used to explain why the time for the lower concentrations was so small a measurement.

Surface area of the liver could have been a factor. The liver was not cut up equally so there for the larger the surface area the molecules have a bigger surface to work on. More useful collisions are made.

This could have also been down to human error where measurements were inaccurate. For instance the concentration of the hydrogen peroxide was measured wrong. Also equipment was not cleaned properly.

Considerations when doing the experiment again :

If I was to do the experiment again I would make sure that the equipment was cleaned properly. Also measurements are taken more accurately and precisely. I will have to make sure the temperature is constant throughout the whole experiment.

Teacher Reviews

Here's what a teacher thought of this essay.

Ross Robertson

Overall, the investigation is based on sound biochemistry and the author demonstrates at least a partial understanding of the factors affecting reaction rates in living organisms. The interaction of substrate and enzyme concentration needed clarification at the start. Substrate concentration was not calculated at any stage, a surprising omission. The DV was not specifically addressed in the report and readers will be a little confused by this. The data collected was not wholly accurate or reproduceable, almost certainly due to the preparation of the liver. A fair effort overall, but with a number of key weaknesses that would certainly undermine the overall grade.

Document Details

Word Count 1625
Level AS and A Level
Subject Science

Related Essays

Investigating the Affect of Hydrogen Peroxide on Liver Catalase.

An investigation to see how different concentrations of aspirin affects hyd...

An Experiment To Investigate The Effect Of Hydrogen Peroxide (Substance) Up...

The breakdown of wastes in liver cells produces hydrogen peroxide which is...

Science & Math
Sociology & Philosophy
Law & Politics

Hydrogen Peroxide Breakdown in Liver vs. Potato

Hydrogen Peroxide Breakdown in Liver…

What gas was produced by the breakdown of hydrogen peroxide ?

Oxygen gas was produced.

Describe the test that was performed in order to identify the gas.

A glowing splint of a match was lit, blown out then inserted into the test tube. The match relighting in the test tube indicates oxygen gas is present.

Can hydrogen peroxide be broken down by catalyst other than those found in a living system?

Hydrogen peroxide can be broken down by manganese dioxide because it has catalytic properties. It is unstable which makes it very reactive. It even breaks down in the presence of light. It increases the rate of a reaction without being changed. Sand however is not able to break it down because it contains no catalytic properties.

Explain how temperature affected the enzyme’s function

Increasing the temperature increased the rate of reaction. There is higher energy when heated. The enzyme was able to catalyze the reaction more quickly. This is only until the point until denaturation. At 40 degrees, the enzyme would experience denaturation causing the rate of reaction to drop. The enzyme would be damaged and not be able to perform the same way.

How did particle size affect the rate of reaction?

The smaller size of particles increased the rate of reaction because smaller particles consume less energy than larger ones to break down molecules, therefore the reaction would happen faster. Larger particles decreased the rate of reaction because they require more energy to break down.

Explain why there is a difference in the rates of reaction between the liver and the potato

The liver contains more of the enzyme catalase, which breaks down hydrogen peroxide. The liver contains more because it detoxifies substances in the body. A larger amount of catalase lowers the activation energy, therefore speeds up the rate of reaction. The potato contains less of the enzyme catalase, therefore requires more activation energy, slowing down the rate of reaction.

Show the fully labeled balanced chemical equation for the decomposition of hydrogen peroxide

2 H2O (aq) –(catalase)—> 2 H2O (l) + O2 (g) hydrogen peroxide enzyme water oxygen gas

Why is it possible to use dead cells to study the function of this enzyme?

Although the cells are dead, catalase still remains active. It remains active in certain temperatures up until the point of denaturation which occurs above 40 degrees. The organism which contained the cells is gone but the cells are still present and active in certain conditions.

Democracy vs. Autocracy
Plant vs. Animal Mitosis
Meiosis vs. Mitosis: Comparison
Decomposition of Hydrogen Peroxide Lab Answers
The Effect of Hydrogen Peroxide on Liver: Hypothesis, Apparatus, Method

The enzyme discussion is amazyingly discuss clearly…

This helped me a lot. Thank you very much

Hypothesis: Liver will have better catalyse activity. Independent ? Dependent ? Helpppp please 🌝

this was very helpful because it was well explained

It was nice but you explain less on catalase in potato

How Does the Liver Burn Fat? Study May Open Doors to New MASLD Treatments

Gerald Shulman, MD, PhD , is very concerned about the state of Americans’ liver health.

Fatty liver disease, also known as metabolic dysfunction-associated steatotic liver disease, or MASLD, affects nearly 40% of U.S. adults and its prevalence is rising fast.

“Fatty liver disease is becoming as important a problem as type 2 diabetes in some ways,” said Shulman, George R. Cowgill Professor of Medicine (Endocrinology) and professor of cellular and molecular physiology at Yale School of Medicine (YSM).

MASLD, which is characterized by excess fat deposits in the liver, is associated with type 2 diabetes and obesity and can itself raise the risk of diabetes and heart disease. But the good news is that fatty liver disease can often be reversed, either through lifestyle changes or medications that reduce the liver’s extra fat.

Shulman and his laboratory team at YSM are interested in understanding the details of how the liver burns fat with the ultimate goal of developing new ways to increase the organ’s fat metabolism and treat MASLD, formerly known as nonalcoholic fatty liver disease (NAFLD). The exact cause of this disease isn’t known but the excess fat can eventually lead to inflammation and liver scarring, or cirrhosis, the same kind of damage that can be caused by excessive alcohol consumption.

In a new study led by Shulman that was published August 16 in the journal Cell Metabolism , the team describes a surprising finding about how mice metabolize fat in their livers: It turns out that this metabolism relies on a different mineral source than had previously been widely accepted in the field.

Liver fat metabolism happens in specialized subcellular compartments known as mitochondria, organelles that also generate all of our cells’ energy. The chemical reactions that turn fat into energy rely on the dietary mineral calcium, and it had long been thought that calcium located inside the mitochondria themselves was the key regulator of these reactions. The Yale study concluded that a different source of calcium in the cell is actually what’s important for the liver fat metabolism, and it further identified a protein that regulates this process.

A hypothesis upended

To understand whether mitochondrial calcium regulates energy production, the researchers turned to a line of mice genetically engineered to lack a certain protein in their liver cells. That protein, called the mitochondrial calcium uniporter or MCU, transports calcium from the rest of the cell into the mitochondria. Mice lacking MCU in their livers indeed have lower levels of calcium in their liver mitochondria, but the team found that, contrary to their expectation, the animals actually had higher rates of mitochondrial metabolism and reduced levels of fat in their livers.

It's a basic science question that is giving us insights into this critical process that could be amenable to treating fatty liver disease as well as type 2 diabetes. Gerald Shulman, MD, PhD

Upon further exploration, Shulman and his colleagues found that calcium in the cytosol, the fluid that fills up cells, appears to drive mitochondrial metabolism. With this finding, it’s now unclear what role calcium plays in the mitochondria, although it’s possible that different tissues in the body may handle their metabolism differently, Shulman said. The researchers also found a specific protein, CAMKII, that appears to regulate this cytosolic calcium-based metabolism.

To uncover these results, the Yale team used a novel technique they had previously developed, called Q-Flux , that captures the flow of molecules into and out of mitochondria in the liver. This technique allowed them to study the rates of metabolic reactions happening in mitochondria in living animals. Most previous studies of mitochondrial metabolism were performed in test tubes in the lab, outside these organelles’ natural context.

“Often what you’re measuring in the mitochondria can be impacted by whatever artificial substrates or conditions you have in the test tube,” Shulman said. “We’re able to measure things under the conditions that liver cells normally experience in vivo.”

The results point to new avenues that could ultimately lead to better drug development for MASLD, Shulman said. There are two mechanisms to reduce fat deposits in the liver: decrease the amount of fat that’s deposited there in the first place or increase liver metabolism to burn more fat. GLP-1 agonist drugs, such as semaglutide (Ozempic), work via the first mechanism to reverse fatty liver disease, but Shulman is interested in finding ways to accomplish the second mechanism as a complement to the first one. The protein they identified as being involved in the process, CAMKII, could be a potential drug target, he said; however, that protein is also involved in glucose production and so interfering with its activity could have other consequences in the body.

“It's a basic science question that is giving us insights into this critical process that could be amenable to treating fatty liver disease as well as type 2 diabetes,” Shulman said.

Featured in this article

Gerald I Shulman, MD, PhD, MACP, MACE, FRCP George R. Cowgill Professor of Medicine (Endocrinology) and Professor of Cellular And Molecular Physiology; Co-Director, Yale Diabetes Research Center, Internal Medicine; Director, Internal Medicine

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

View all journals
Explore content
About the journal
Publish with us
Sign up for alerts
Open access
Published: 20 August 2024

Far-infrared radiation alleviates steatohepatitis and fibrosis in metabolic dysfunction-associated fatty liver disease

Tianyi Xu 1 ,
Haijing Fu 1 ,
Wumei Zhao 1 &
Shijun Shan 1 , 2 , 3

Scientific Reports volume 14 , Article number: 19292 ( 2024 ) Cite this article

141 Accesses

Metrics details

Health care
Medical research
Molecular medicine

Metabolic dysfunction-associated fatty liver disease (MAFLD) is a disease that causes an abnormal accumulation of fat in the liver, triggering inflammation and fibrosis, the mechanism of which is not fully understood and for which there is a lack of specific drug therapy. Far-infrared radiation (FIR) has demonstrated evident therapeutic efficacy across various diseases, and novel nanomaterial graphene patches can emit it through electric heating. This study aimed to investigate the potential protective effects of FIR against MAFLD. Mice were fed with a MCD diet to mimic MAFLD progression, and histopathology analysis, biochemical analysis, RT-qPCR, and Western blotting analysis were performed to assess the effect of FIR on MAFLD in vivo. The effect of FIR treatment on MAFLD in vitro was investigated by biochemical analysis and gene expression profiling of hepatocytes. Mice subjected to the MCD diet and treated with FIR exhibited reduced hepatic lipid deposition, inflammation, fibrosis and liver damage. The therapeutic effect exerted by FIR in mice may be caused by the enhancement of AMPK phosphorylation and inhibition of the TGFβ1-SMAD2/3 pathway. Besides, FIR intervention alleviated MAFLD in hepatocytes in vitro and the results were verified by gene expression profiling. Our results revealed a promising potential of FIR as a novel therapeutic approach for MAFLD.

Oxidative stress in obesity-associated hepatocellular carcinoma: sources, signaling and therapeutic challenges

Neohesperidin enhances PGC-1α-mediated mitochondrial biogenesis and alleviates hepatic steatosis in high fat diet fed mice

Silencing hepatic MCJ attenuates non-alcoholic fatty liver disease (NAFLD) by increasing mitochondrial fatty acid oxidation

Introduction.

Metabolic dysfunction-associated fatty liver disease (MAFLD) stands as the most prevalent chronic liver disease worldwide, with its incidence continuing to rise in recent years 1 . This increasing prevalence poses a growing economic burden, accompanied by a surge in patients suffering from cirrhosis and end-stage liver disease 2 , 3 , 4 . Excessive accumulation of fat within the liver is one of the hallmark features associated with MAFLD. Histologically, MAFLD is typically diagnosed by the occurrence of steatosis in more than 5% of hepatocytes 5 . MAFLD encompasses a spectrum of liver disorders, including isolated steatosis, metabolic dysfunction-associated steatohepatitis (MASH), advanced fibrosis, cirrhosis, and hepatocellular carcinoma (HCC) 6 . Interestingly, the adverse effects of MAFLD extend beyond the liver to other organs. Mounting clinical evidence points to the revelation that MAFLD and cardiovascular disease are mutually aggravating. MAFLD serves as an independent risk factor for various cardiovascular conditions, which in turn exacerbates cardiovascular disease, and vice versa 7 . Despite the escalating impact of MAFLD, there is currently a lack of FDA-approved pharmaceutical drugs for the effective treatment of this condition 8 .

The graphene patch employed in this study is a novel nanomaterial composed of sp2 hybrid carbon atoms arranged in a hexagonal lattice. It possesses the capability to be precisely adjusted to the desired treatment temperature and primarily emits far-infrared radiation (FIR) in the wavelength range of 3.0–100 microns. In therapeutic applications, FIR-generated energy can be absorbed as mild radiant heat 9 . The interaction between electromagnetic radiation within the FIR spectrum and biological structures, as well as living systems, exerts two noteworthy effects. Firstly, FIR can alter cell membrane potentials and mitochondrial metabolism 10 . Secondly, FIR energy can be absorbed by the vibrational energy levels of molecular bonds. Considering the high water proportion in biological systems, coupled with the solvation effect and the dielectric properties of water, the therapeutic benefits of FIR treatment stem from the vibrating water molecules 11 . FIR has demonstrated a multitude of biological effects with successful application in various medical treatments 12 . Nevertheless, its specific therapeutic role in addressing MAFLD has yet to be elucidated.

The primary objective of this study was to explore the therapeutic potential of FIR in treating MAFLD and to unveil the possible underlying mechanism. Our investigations revealed that FIR, emitted from an electric graphene patch, could alleviate the MAFLD model in both in vivo and in vitro. The therapeutic mechanism probably involved the activation of the AMPK pathway and the inhibition of the TGFβ1-SMAD2/3 pathway.

FIR treatment reduces MCD diet-induced hepatic lipid deposition

The mice were subjected to a 2-week administration of the MCD diet, followed by alternate-day FIR therapy for 4 weeks, concurrently maintaining the continuous MCD diet regimen. In mice exhibiting MAFLD induced by MCD diet, body weight was marginally increased in the FIR-treated groups, while liver weight remained unaltered (Fig. 1 a–c). Consequently, FIR treatment mitigated the elevation in the liver index (liver/body weight ratio) caused by the MCD diet (Fig. 1 d). Evaluation of liver sections through H&E and ORO staining in each group indicated an evident reduction in hepatic lipid accumulation of FIR treatment group (Fig. 1 e). These findings were further corroborated by the results of liver-specific TG and TC assays (Fig. 1 f,g). Serum analysis through various biochemical assays also revealed a decrease in TG, TC, and LDL-C levels, along with a rise in HDL-C levels (Fig. 1 h-k).

Effect of FIR on hepatic lipid deposition in MAFLD mouse model. Liver tissues and serum were harvested from mice fed with NC (normal chow) or MCD diet and subsequently treated with FIR1 (39 °C) or FIR2 (41 °C), for 1 h every alternate day. ( a ) Weekly body weight; ( b , c ) final body weight, liver weight; ( d ) liver weight to body weight ratio; ( e ) gross livers, H&E staining and oil red O staining of liver sections; ( f , g ) hepatic levels of TG, TC; ( h – k ) serum levels of TG, TC, HDL-C and LDL-C; ( l – p ) mRNA expression of 5 genes normalized against Hprt; ( q ) protein levels of 6 proteins with β-tubulin as internal reference; ( r , s ) normalized ratio of phosphorylated to total protein fluorescence intensity in three independent experiments. Asterisks indicate statistical significance (*p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001) compared to the MCD diet group.

RT-qPCR analyses revealed the downregulation of marker genes associated with lipogenesis (CD36, FASN, PDK4), while marker genes linked to fatty acid oxidation (PPARα, ACC1) were upregulated in the FIR-treated groups (Fig. 1 l–p). These results were consistently supported by western blot analyses (Fig. 1 q,r). Considering the pivotal role of the AMPK signaling pathway in lipid metabolism specific to MAFLD, we hypothesized that FIR treatment reduced lipid deposition through AMPK activation. As anticipated, increased AMPK phosphorylation in the liver tissue was observed following FIR treatment, thereby promoting metabolic activity (Fig. 1 q,s). Notably, the temperature of FIR treatment did not appear to exert a discernible impact on the therapeutic outcome.

FIR treatment attenuates MCD diet-induced hepatic inflammation

Inflammation has been recognized as a key process in the pathogenesis and development of MAFLD, often characterized by hepatic lipid steatosis 15 . To evaluate the effect of FIR treatment on liver inflammation in MAFLD, we conducted F4/80 immunofluorescence staining of liver sections and found that FIR treatment led to an attenuation of hepatic inflammation in the MCD-induced MAFLD mouse model (Fig. 2 a). Then Real-time PCR was performed to detect the expression of related genes. PCR analyses of the total RNA extracted from the liver tissues of the 4 experimental mice groups revealed a notable downregulation in the expression of marker genes related to inflammatory response, including MCP1, TNF-α, CCR2, IL-1β, CXCL10, NLRP3 (Fig. 2 b–g). Additionally, the hepatic injury was also reduced by FIR treatment, with evident alleviation of elevated ALT and AST levels in response to the MCD diet (Fig. 2 h,i). Similar to hepatic lipid deposition results, the FIR treatment temperature exhibited minimal impact on the attenuation of hepatic inflammation.

Effect of FIR on hepatic inflammation in MAFLD mouse model. Liver tissues were harvested from mice fed with NC (normal chow) or MCD diet, followed by treatment with FIR1 (39 °C) or FIR2 (41 °C) for 1 h every other day. ( a ) F4/80 immunofluorescence staining of liver sections; ( b – g ) mRNA expression of 6 genes normalized by Hprt; ( h , i ) serum levels of ALT, AST. Asterisks indicate statistical significance (*p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001) compared to the MCD diet group.

FIR treatment mitigates MCD diet-induced hepatic fibrosis

As a major lesion in the middle and late stages of MAFLD, the severity of liver fibrosis determines the prognosis of the disease. We stained liver sections with PSR, and under the microscope, red collagen fibers were seen to be predominant in the MCD-induced model group, while collagen fibers were reduced in both FIR-treated groups (Fig. 3 a). The results of PCR assay further verified this conclusion that the expression of liver fibrosis-related genes including Col1a1, Acta2, Ctgf, Loxl2, Timp1, Mmp13, Pai1 and TGFβ1 was down-regulated in the FIR-treated group (Fig. 3 b–i). The results of western blot experiments showed that the increased phosphorylated SMAD2/3 proteins in the model group were significantly reduced in the FIR-treated group (Fig. 3 j,k). The activation of the TGFβ1-SMAD2/3 pathway is one of the classical pathways responsible for the development of hepatic fibrosis in patients with MAFLD, and the FIR treatment may have attenuated the hepatic fibrosis in the model mice by inhibiting this pathway.

Effect of FIR on hepatic fibrosis in MAFLD mouse model. Liver tissues were harvested from mice fed with NC (normal chow) or MCD diet and subsequently treated with FIR1 (39 °C) or FIR2 (41 °C) for 1 h every alternate day. ( a ) PSR staining of liver sections; ( b – i ) mRNA expression of 8 genes normalized by Hprt; ( j ) protein levels of 2 proteins with β-tubulin or β-actin as internal reference; ( k ) normalized ratio of phosphorylated to total protein fluorescence intensity in three independent experiments. Asterisks indicate statistical significance (*p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001) compared to the MCD diet group.

FIR treatment alleviates MAFLD in hepatocytes in vitro

Primary mouse hepatocytes and HepG2 cells were exposed to MASH cocktail and sodium palmitate, respectively, to investigate the effects of FIR treatment on hepatocytes in vitro. The examination of cytotoxicity in HepG2 cells through CCK-8 assays revealed that cell viability remained above 90% when exposed to FIR treatment at 39 °C (Fig. 4 a). FIR treatment commenced 2 h after introducing the steatosis-inducing drug into the culture medium. Accordingly, two treatment groups were established, namely FIR1 and FIR2, each receiving treatment for 12 and 24 h per day, respectively. After two days, the cells were fixed for ORO staining and simultaneously harvested for TG and TC assays. A reduction in the numbers and sizes of lipid droplets was observed post-treatment, suggesting the alleviation of drug-induced steatosis in both cells (Fig. 4 b). Furthermore, TG content was reduced in primary mouse hepatocytes as well as HepG2 cells (Fig. 4 c,e), whereas the TC levels did not exhibit apparent changes in response to FIR treatment (Fig. 4 d,f).

Effect of FIR on hepatocytes in MAFLD cell model. The mouse primary hepatocytes and HepG2 cells were induced with MASH cocktail to be model group (MOD). Both were then treated with FIR1 (39 °C, 12 h) or FIR2 (39 °C, 24 h) for 2 days. ( a ) Cytotoxic effects of FIR on HepG2 cells; ( b ) oil red O staining of hepatocytes; ( c , d ) TG and TC contents in mouse primary hepatocytes; ( e , f ) TG and TC contents in HepG2 cells; ( g ) PCA plot for all groups; ( h ) volcano plot for DEGs from MOD and FIR; ( i , j ) heat map for DEGs from MOD and FIR; ( k ) GO enrichment analysis for MOD versus FIR; ( l ) KEGG pathway enrichment analysis for MOD versus FIR. Asterisks refer to statistical significance (*p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001) in comparison to MOD group.

We performed gene expression profiling of mRNA sequences from primary mouse hepatocyte samples. The principal component analysis plot showed negligible differences within groups (Fig. 4 g). From the volcano plot of differentially expressed genes (DEGs), more genes were downregulated in the FIR-treated group compared to the model group (Fig. 4 h). The information in the heat map of DEGs suggests that the FIR treatment had a beneficial effect on reducing lipids, attenuating inflammation, and alleviating fibrosis (Fig. 4 i,j). Similarly, GO enrichment of DEGs revealed that the DEGs were involved in lipid metabolism, inflammation and fibrosis biological processes or executed related molecular functions (Fig. 4 k). KEGG pathway enrichment was also added to confirm this series of findings (Fig. 4 l).

In recent years, metabolic dysfunction-associated fatty liver disease has emerged as the most prevalent chronic liver disorder, afflicting approximately 25% of the global adult population 16 . MAFLD has now swiftly ascended to become the leading cause of liver-related mortality worldwide 17 , emphasizing the pressing need for effective therapeutic measures. While lifestyle modifications, including dietary changes, exercise, and weight loss, represent major treatment strategies for mild MAFLD patients 18 , more advanced disease conditions often require pharmacological interventions. The most frequently employed pharmacological interventions involve drugs related to glucose and lipid metabolism, such as PPAR, bile acids (BAs) therapeutics, farnesoid X receptor (FXR) agonists, and thyroid hormone receptor-β (THR-β) agonists 19 . Additionally, anti-cellular stress medicines, including vitamin E, antioxidant carotenoid beta-cryptoxanthin, melatonin, coenzyme Q10 curcumin, green tea, epigallocatechin gallate, and anti-apoptosis agents are also commonly applied in MAFLD therapy 20 , 21 , 22 , 23 , 24 , 25 , 26 , 27 . However, the long-term efficacy and safety of these drugs remain subjects of clarification.

FIR represents a sub-division of the electromagnetic spectrum, residing between the long-wavelength red edge of the visible spectrum and the shorter edge of the terahertz spectral bands. The International Commission on Illumination (CIE) classifies infrared radiation (IR) into three sub-divisions: near-infrared (0.7–1.4 microns), mid-infrared (1.4–3.0 microns), and far-infrared (3.0–100 microns) 12 . Importantly, only FIR transmits energy in the form of pure thermal energy, perceptible to the thermal receptors of human skin as radiant heat. The graphene patch used in this study predominantly emits FIR following electrical heating. FIR has found extensive application in medical and healthcare domains. For example, FIR demonstrated the ability to inhibit peroxide production by macrophages and block reactive oxygen species (ROS)-mediated cytotoxicity 28 . Moreover, FIR enhanced the production of intracellular nitric oxide in breast cancer cells and inhibited the growth of melanoma cells 29 . FIR sauna therapy has gained prominence in Japan and South Korea, particularly in the management of cardiovascular diseases 30 , 31 . A recent report has documented a positive therapeutic effect of FIR against allergic rhinitis 32 .

However, there is a dearth of studies concerning the potential therapeutic impact of FIR on MAFLD. To investigate this prospect, we established MCD diet-induced MAFLD mouse models and MASH cell models. In previous studies, exposing mice to hyperthermia at 42 °C reduced the number of circulating antithrombin, causing thrombus formation to block blood vessels, further triggering localized tissue hypoxia and ultimately leading to cell damage 33 . Exposure to 40.5 °C probably decreased the cell viability of isolated mouse hepatocytes by 35%, possibly due to membrane instability and dysfunctional mitochondria and protein transport 34 . At temperatures exceeding 41 °C, protein denaturation increases, thus promoting apoptosis 35 . Accordingly, a temperature range of 39–41 °C was selected for FIR treatment. Indeed, FIR treatment has been found to have a series of beneficial effects on the MAFLD model both in vivo and in vitro, but at the same time, no marked difference in the FIR therapeutic properties was observed within this temperature range. Likewise, variations in the FIR treatment duration for cell models, spanning from 12 to 24 h, appeared to exert minimal influence on treatment outcome. Our study was limited to the cell model in vitro and the MCD diet-induced mouse model. Although the pathophysiologic manifestations of this animal model in terms of steatohepatitis and liver fibrosis are quite similar to those of MAFLD patients, it does not match the actual clinical status of most MAFLD patients on weight gain and fat accumulation. To further explore the ameliorative effects of FIR on MAFLD, more other animal models are currently needed to deepen our understanding of this novel therapeutic modality. Additionally, research on more profound mechanisms needs to be further explored as well.

MAFLD is a disease with an ever-expanding impact, but no therapeutic drug has yet been approved by the FDA specifically for its treatment. Given its high prevalence and potential long-term health hazards, it has become critical to find more effective treatments. FIR, as a form of physical therapy, exhibits unique advantages in the treatment of MAFLD. First, FIR therapies typically have fewer side effects compared to medications. Second, FIR therapy has the advantage of being non-invasive compared to surgical therapy. In addition, compared with dietary modification and exercise, which are currently the most recognized lifestyle modification therapies, FIR physiotherapy offers a higher level of ease of use and comfort, and this ease of use can significantly improve patient adherence to treatment, thus enhancing the remission effect of MAFLD. In future studies, the feasibility of FIR therapy can be further broadened so that it can serve MAFLD patients as a safe, non-invasive, and comfortable new treatment option.

In this study, we observed that FIR treatment resulted in the reduction of hepatic lipid deposition, inflammation, fibrosis and liver damage in mice induced by the MCD diet. It also alleviates MAFLD in hepatocytes in vitro. The effects may be caused by the activation of AMPK and inhibition of the TGFβ1-SMAD2/3 pathway. Collectively, the possible potential of FIR as a novel therapeutic approach for MAFLD has been illustrated.

Materials and methods

Graphene patch.

We obtained graphene patches with a total resistance of about 15 Ω and a power density of about 67 mW·cm −2 at 5 V by uniformly printing graphene conductive ink on flexible polyimide foils. As an innovative nanomaterial, the main part of our graphene patch consists of sp2 hybrid carbon atoms organized in a hexagonal lattice. The patch has many advantages, including no resistance change by deformation, a constant temperature over a range of voltages, and a good match of the far-infrared radiation emission peaks of 8–9 μm to the reported FIR peaks in mice and human beings 12 . Details about the fabrication method and physical properties of the graphene patches are described in this article we cited 13 . In short, it is an ideal far-infrared radiation tool for conducting this experiment.

Eight-week-old male C57BL/6 mice were acquired from GemPharmatech (CHN), and subsequently housed and raised in the standard pathogen-free (SPF) environment in Xiamen University. All animal experiments conducted in this study were approved by the Institutional Animal Care and Use Committee of Xiamen University. Following a one-week adaptation period to the new environment, the mice were divided into four distinct groups: one group was fed the normal diet, and the remaining three groups were subjected to an MCD (Methionine-Choline Deficient) diet (Dyets CHN) for six weeks to establish the MAFLD mouse model. FIR-treated groups were categorized into two treatment groups, denoted as FIR1 and FIR2; mice in these two groups were generally anesthetized by isoflurane gas and enveloped in graphene patches electrically heated to 39 °C or 41 °C, respectively, around the abdominal region for one hour during the treatment protocol. At the end of the experimental period, all mice were anesthetized by isoflurane gas and then executed by cervical dislocation. Xiamen University’s Animal Care and Use Committee approved the experiment (approval number XMULAC20190070).

Liver tissue specimens were initially fixed in a 4% paraformaldehyde solution for 24 h, followed by dehydration and embedding in molten paraffin. The resulting paraffin blocks were sliced into 5 μm thick sections and then subjected to hematoxylin–eosin (H&E), Sirius red (PSR) and F4/80 Immunohistochemical fluoresce staining. For oil red O (ORO) staining, liver tissue samples were first fixed in 4% paraformaldehyde solution for 20 min, and then dehydrated with 30% sucrose solution at 4 °C overnight. Consecutively, the tissue samples were embedded in OCT (Optimal Cutting Temperature) (SAKURA USA 4583) and sectioned into 10 μm frozen slices for staining.

Biochemistry

Biochemical analysis of the serum samples involved the utilization of assay kits to assess various parameters, including triglycerides (TG) (Applygen CHN E1003), total cholesterol (TC) (Applygen CHN E1005), high-density lipoprotein cholesterol (HDL-C) (Applygen CHN E1017), low-density lipoprotein cholesterol (LDL-C) (Applygen CHN E1018), alanine aminotransferase (ALT) (Applygen CHN E2021) and aspartate aminotransferase (AST) (Applygen CHN E2023). Analysis of the liver tissue samples specifically employed TG and TC kits (Applygen CHN E1025, E1026). For quantification, the optical density (OD) values were measured using a SpectraMax ® Absorbance Reader (Molecular Devices CHN).

Cell isolation

Collagenase D solution (Sigma USA V900893) was perfused into the inferior vena cava (IVC) of experimental mice under anesthesia. Subsequently, the liver was carefully extracted and minced gently in a solution containing DMEM, 5% FBS, 1% penicillin/streptomycin, 0.5% insulin–transferrin–sodium selenite (Procell CHN PB180429) and 0.3% dexamethasone (selleck USA S1322). Following this, a series of steps, including filtration, centrifugation, and removal of dead cells, were carried out and finally, the cells were cultured in collagen-coated dishes (Solarbio CNH C8062-10 mg).

Cell culture

Primary hepatocytes were isolated from 8-week-old male C57BL/6 mice and were cultivated in collagen-coated dishes containing DMEM medium supplemented with 1% penicillin/streptomycin, 0.5% insulin–transferrin–sodium selenite and 0.2% dexamethasone. Besides, HepG2 cells were grown in DMEM medium supplemented with 10% FBS and 1% penicillin/streptomycin. All cell cultures were maintained in a humidified incubator at 37 °C with 5% CO 2 under sterile conditions. To establish a MASH cell model using primary mouse hepatocytes, a MASH cocktail consisting of 0.3 mM sodium palmitate (Sigma USA P0500-10G), 0.3 mM sodium oleate (Sigma USA O7501-1G), 5.5 mM sucrose (Sigma USA G-8644), 10 mM fructose (Sigma USA F3510), and 10 μg/μl lipopolysaccharide (LPS) (Invivogen FRA tlrl-3pelps) was added to the culture medium. Likewise, cellular lipotoxicity was induced in HepG2 cells by adding 0.3 mM sodium palmitate into the medium 14 . After 2 h, a graphene patch heated to 39 °C was placed beneath the cell culture dishes for 12 or 24 h corresponding to the two treatment groups, FIR1 and FIR2. For ORO staining, cells were fixed with a 4% paraformaldehyde solution. Cellular lipid accumulation was assessed using TG and TC assay kits (Applygen CHN E1025, E1026). Cell counting kit-8 (CCK-8) (GLPBIO USA GK10001) was used to evaluate cell viability.

Gene expression profiling

Mouse primary hepatocyte samples were sent to Gene Denovo Biotechnology Co. (Guangzhou, China). Total RNA was extracted using Trizol reagent, and mRNA was enriched by Oligo (dT) beads. The enriched mRNA was fragmented into short fragments and reversely transcribed into cDNA. The purified double-stranded cDNA fragments were end-repaired, A base added and ligated to Illumina sequencing adapters. The ligation reaction was purified with the AMPure XP Beads (1.0X), and the polymerase chain reaction (PCR) was amplified. The resulting cDNA library was sequenced using Illumina Novaseq 6000. The follow-up bioinformatics analyses were performed on the Omicsmart platform ( https://www.omicsmart.com/ ).

Western blotting

Tissues and cells used in this study were lysed using a denaturing lysis buffer containing HEPES, NaCl, EDTA, and 10% SDS supplemented with proteinase and phosphatase inhibitor cocktail (Apexbio USA K1011, K1015). Lysates were boiled for 3 min and homogenized by sonication using a digital sonifier FS-350 T (Sxsonic China). Protein concentrations were quantified employing a BCA protein assay kit (Thermo USA 23227). For western blotting, the protein samples were mixed with loading buffer and boiled for 5 min at 95 °C. The samples were then separated on a 4–20% Tris-Tricine precast gel (ACEBio CHN ET15420LGel), and subsequently transferred to a polyvinylidene difluoride (PVDF) membrane (Roche SUI 3010040001). Next, the membranes were blocked using a blocking buffer (LI-COR USA 927-70001) for 1.5 h, followed by immunoblotting with primary antibodies first and fluorescent secondary antibodies afterward (LI-COR USA 926-32213, 926-68072). The immunoblots were finally imaged using the fluorescent Odyssey System (LI-COR USA). All western blotting images presented in the manuscript are representative of 3 independent experiments.

Total RNA from liver tissues was extracted using a combination of Trizol reagent (Sigma USA T9424) and chloroform employing the TRnaZol RNA Kit (NCM Biotech CHN M5102). The reverse transcription of RNA to cDNA was performed using the Superscript III RT-PCR Kit (Vazyme CHN R323-01). The cDNA synthesis process was facilitated in a C1000 Touch™ Thermal Cycler (Bio-Rad USA). Quantitative PCR was conducted using SYBR Green qPCR Master Mix (Selleck USA B21202) according to the manufacturer’s protocols on the Qtower real-time machine (Analytikjena, Swavesey, Cambridge GBR). The housekeeping gene Hprt was utilized as a reference to normalize the relative gene expression levels.

All experiments conducted were independently repeated a minimum of 3 times, and generated data were statistically analyzed using GraphPad Prism 9 software. To compare multiple groups, a one-way analysis of variance (ANOVA was adopted for statistical analysis. Quantitative results are presented as mean ± standard error of the mean (SEM). Statistical significance was determined with a threshold p-value of less than 0.05, indicated by asterisks as *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

Institutional review board statement

The animal study protocol was approved by Xiamen University’s Animal Care and Use Committee approved the experiment (approval number XMULAC20190070). All methods were carried out in accordance with relevant guidelines and regulations. All methods are reported in accordance with ARRIVE guidelines (Supplementary Information S1 ).

Data availability

All data used in this study can be obtained from the corresponding author. The raw sequences have been deposited on BIG Sub website of China national center for Bioinformation ( https://ngdc.cncb.ac.cn/gsub/ ) and the accession number is CRA014758.

Cai, J., Zhang, X. J. & Li, H. Progress and challenges in the prevention and control of nonalcoholic fatty liver disease. Med. Res. Rev. 39 (1), 328–348 (2019).

Article PubMed Google Scholar

Younossi, Z. M. et al. The economic and clinical burden of nonalcoholic fatty liver disease in the United States and Europe. Hepatology 64 (5), 1577–1586 (2016).

Goldberg, D. et al. Changes in the prevalence of hepatitis C virus infection, nonalcoholic steatohepatitis, and alcoholic liver disease among patients with cirrhosis or liver failure on the waitlist for liver transplantation. Gastroenterology 152 (5), 1090–1099 (2017).

Wong, R. J. et al. Nonalcoholic steatohepatitis is the second leading etiology of liver disease among adults awaiting liver transplantation in the United States. Gastroenterology 148 (3), 547–555 (2015).

European Association for the Study of the, L., D. European Association for the Study of, and O. European Association for the Study of, EASL-EASD-EASO Clinical Practice Guidelines for the management of non-alcoholic fatty liver disease. Diabetologia 59 (6), 1121–1140 (2016).

Younes, R. & Bugianesi, E. Should we undertake surveillance for HCC in patients with NAFLD?. J. Hepatol. 68 (2), 326–334 (2018).

Lonardo, A. et al. Hypertension, diabetes, atherosclerosis and NASH: Cause or consequence?. J. Hepatol. 68 (2), 335–352 (2018).

Powell, E. E., Wong, V. W. & Rinella, M. Non-alcoholic fatty liver disease. Lancet 397 (10290), 2212–2224 (2021).

Article CAS PubMed Google Scholar

Plaghki, L. et al. The fine tuning of pain thresholds: A sophisticated double alarm system. PLoS One 5 (4), e10269 (2010).

Article ADS PubMed PubMed Central Google Scholar

Sheppard, A. R., Swicord, M. L. & Balzano, Q. Quantitative evaluations of mechanisms of radiofrequency interactions with biological molecules and processes. Health Phys. 95 (4), 365–396 (2008).

Lee, M. S. et al. Far-infrared absorption of water clusters by first-principles molecular dynamics. J. Chem. Phys. 128 (21), 214506 (2008).

Article ADS PubMed Google Scholar

Vatansever, F. & Hamblin, M. R. Far infrared radiation (FIR): Its biological effects and medical applications. Photon. Lasers Med. 4 , 255–266 (2012).

Google Scholar

Shi, C. R. et al. Boosting the immunoactivity of T cells by resonant thermal radiation from electric graphene films for improved cancer immunotherapy. Adv. Ther. 6 (2), 1 (2023).

Fang, Z. et al. Short-term tamoxifen administration improves hepatic steatosis and glucose intolerance through JNK/MAPK in mice. Signal Transduct. Target Ther. 8 (1), 94 (2023).

Article CAS PubMed PubMed Central Google Scholar

Wang, Q. et al. Naringenin attenuates non-alcoholic fatty liver disease by down-regulating the NLRP3/NF-kappaB pathway in mice. Br. J. Pharmacol. 177 (8), 1806–1821 (2020).

Younossi, Z. M. et al. Global epidemiology of nonalcoholic fatty liver disease-meta-analytic assessment of prevalence, incidence, and outcomes. Hepatology 64 (1), 73–84 (2016).

Paik, J. M. et al. Changes in the global burden of chronic liver diseases from 2012 to 2017: The growing impact of NAFLD. Hepatology 72 (5), 1605–1616 (2020).

Vachliotis, I. D. et al. Association between hepatic steatosis and fibrosis indices and dietary habits, physical activity, and quality of life. Arab. J. Gastroenterol. 23 (4), 277–287 (2022).

Xu, X. et al. Targeted therapeutics and novel signaling pathways in non-alcohol-associated fatty liver/steatohepatitis (NAFL/NASH). Signal Transduct Target Ther. 7 (1), 287 (2022).

Article PubMed PubMed Central Google Scholar

Evans, H. M. & Bishop, K. S. On the existence of a hitherto unrecognized dietary factor essential for reproduction. Science 56 (1458), 650–651 (1922).

Article ADS CAS PubMed Google Scholar

Ni, Y. et al. Prevention and reversal of lipotoxicity-induced hepatic insulin resistance and steatohepatitis in mice by an antioxidant carotenoid, beta-cryptoxanthin. Endocrinology 156 (3), 987–999 (2015).

Dludla, P. V. et al. Coenzyme Q(10) supplementation improves adipokine levels and alleviates inflammation and lipid peroxidation in conditions of metabolic syndrome: A meta-analysis of randomized controlled trials. Int. J. Mol. Sci. 21 (9), 1 (2020).

Article Google Scholar

Inzaugarat, M. E. et al. New evidence for the therapeutic potential of curcumin to treat nonalcoholic fatty liver disease in humans. PLoS One 12 (3), e0172900 (2017).

Lee, D. E. et al. Curcumin ameliorates nonalcoholic fatty liver disease through inhibition of O-GlcNAcylation. Nutrients 11 (11), 1 (2019).

Article CAS Google Scholar

Kuzu, N. et al. Epigallocatechin gallate attenuates experimental non-alcoholic steatohepatitis induced by high fat diet. J. Gastroenterol. Hepatol. 23 (8 Pt 2), e465–e470 (2008).

CAS PubMed Google Scholar

Xiao, J. et al. Epigallocatechin gallate attenuates fibrosis, oxidative stress, and inflammation in non-alcoholic fatty liver disease rat model through TGF/SMAD, PI3 K/Akt/FoxO1, and NF-kappa B pathways. Eur. J. Nutr. 53 (1), 187–199 (2014).

Bessone, F., Razori, M. V. & Roma, M. G. Molecular pathways of nonalcoholic fatty liver disease development and progression. Cell Mol. Life Sci. 76 (1), 99–128 (2019).

Leung, T. K. et al. Direct and indirect effects of ceramic far infrared radiation on the hydrogen peroxide-scavenging capacity and on murine macrophages under oxidative stress. J. Med. Biol. Eng. 31 (5), 345–351 (2011).

Leung, T. K. et al. Inhibitory effects of far-infrared irradiation generated by ceramic material on murine melanoma cell growth. Int. J. Photoenergy 1 , 1 (2012).

Kihara, T. et al. Waon therapy improves the prognosis of patients with chronic heart failure. J. Cardiol. 53 (2), 214–218 (2009).

Tei, C. et al. Waon therapy improves peripheral arterial disease. J. Am. Coll. Cardiol. 50 (22), 2169–2171 (2007).

Lin, C. C. et al. Far-infrared therapy: A novel treatment to improve access blood flow and unassisted patency of arteriovenous fistula in hemodialysis patients. J. Am. Soc. Nephrol. 18 (3), 985–992 (2007).

Hernández-Espinosa, D. et al. effects of hyperthermia on the functional and conformational characteristics of antithrombin. J. Thrombosis Haemost. 5 (5), 963–970 (2007).

Araújo, A. M. et al. Hepatic metabolic derangements triggered by hyperthermia: An in vitro metabolomic study. Metabolites 9 (10), 1 (2019).

Walter, E. J. et al. The pathophysiological basis and consequences of fever. Crit. Care 20 (1), 200 (2016).

Download references

Acknowledgements

We give thanks for the guidance and technical help of Professor Lingjuan Zhang and Xiao Liu, School of Pharmacy, Xiamen University.

This research was funded by the National Natural Science Foundation of China, grand number 81972953, SJS and the Xiamen Clinical Key Specialty Construction Program Fund, grand number PM202109150002.

Author information

Authors and affiliations.

Department of Dermatology, Xiang’an Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen, 361000, China

Tianyi Xu, Haijing Fu, Wumei Zhao & Shijun Shan

Chen Hongduo Academician Workstation, Shaoxing Central Hospital, Shaoxing, China

Shijun Shan

Hangzhou Third People′s Hospital, Affiliated Hangzhou Dermatology Hospital, Zhejiang University School of Medicine, Hangzhou, China

You can also search for this author in PubMed Google Scholar

Contributions

T.X: conceptualization, formal analysis and writing the original draft; H.F., W.Z. and C.Y: review and editing; S.S: project administration and funding acquisition. All authors have read and agreed to the published version of the manuscript.

Corresponding author

Correspondence to Shijun Shan .

Ethics declarations

Competing interests.

The authors declare no competing interests.

Additional information

Publisher's note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Supplementary information., rights and permissions.

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/ .

Reprints and permissions

About this article

Cite this article.

Xu, T., Fu, H., Zhao, W. et al. Far-infrared radiation alleviates steatohepatitis and fibrosis in metabolic dysfunction-associated fatty liver disease. Sci Rep 14 , 19292 (2024). https://doi.org/10.1038/s41598-024-69053-8

Download citation

Received : 08 February 2024

Accepted : 31 July 2024

Published : 20 August 2024

DOI : https://doi.org/10.1038/s41598-024-69053-8

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

Far-infrared radiation

By submitting a comment you agree to abide by our Terms and Community Guidelines . If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Quick links

Explore articles by subject
Guide to authors
Editorial policies

Information

Author Services

Initiatives

You are accessing a machine-readable page. In order to be human-readable, please install an RSS reader.

All articles published by MDPI are made immediately available worldwide under an open access license. No special permission is required to reuse all or part of the article published by MDPI, including figures and tables. For articles published under an open access Creative Common CC BY license, any part of the article may be reused without permission provided that the original article is clearly cited. For more information, please refer to https://www.mdpi.com/openaccess .

Feature papers represent the most advanced research with significant potential for high impact in the field. A Feature Paper should be a substantial original Article that involves several techniques or approaches, provides an outlook for future research directions and describes possible research applications.

Feature papers are submitted upon individual invitation or recommendation by the scientific editors and must receive positive feedback from the reviewers.

Editor’s Choice articles are based on recommendations by the scientific editors of MDPI journals from around the world. Editors select a small number of articles recently published in the journal that they believe will be particularly interesting to readers, or important in the respective research area. The aim is to provide a snapshot of some of the most exciting work published in the various research areas of the journal.

Original Submission Date Received: .

Active Journals
Find a Journal
Proceedings Series
For Authors
For Reviewers
For Editors
For Librarians
For Publishers
For Societies
For Conference Organizers
Open Access Policy
Institutional Open Access Program
Special Issues Guidelines
Editorial Process
Research and Publication Ethics
Article Processing Charges
Testimonials
Preprints.org
SciProfiles
Encyclopedia

Article Menu

Subscribe SciFeed
Recommended Articles
Google Scholar
on Google Scholar
Table of Contents

Find support for a specific problem in the support section of our website.

Please let us know what you think of our products and services.

Visit our dedicated information section to learn more about MDPI.

JSmol Viewer

Effects of feeding rates on growth performance and liver glucose metabolism in juvenile largemouth bronze gudgeon ( coreius guichenoti ).

Simple Summary

1. introduction, 2. materials and methods, 2.1. experimental design and breeding management, 2.2. sample collection and growth index calculation, 2.3. liver physiological parameters detection, 2.4. liver tissue section examination, 2.5. rna isolation, reverse transcription, and quantitative real-time pcr analysis, 2.6. data statistics and analysis, 3.1. effects of feeding rates on the growth performance, 3.2. effects of feeding rates on liver tissue sections and glycogen synthesis, 3.3. effects of feeding rate on plasma glucose, liver glycolysis, and gluconeogenesis metabolism-related enzyme activities and gene expression, 4. discussion, 4.1. effects of feeding rate on the growth performance, 4.2. effects of feeding rate on glucose metabolism, 5. conclusions, author contributions, institutional review board statement, informed consent statement, data availability statement, conflicts of interest.

Ge, Q.X.; Wang, Z.J.; Zhang, H.X. Study on the hepatopancreases of Coreius heterodon (Bleeker) and Coreius guichenoti (Sauvage et Dabry) in Yangtze River. J. Quanzhou Norm. Univ. 2001 , 19 , 69–74. (In Chinese) [ Google Scholar ]
Jiang, W.; Liu, H.Z.; Duan, Z.H.; Cao, W.X. Seasonal variation in drifting eggs and larvae in the upper Yangtze, China. Zool. Sci. 2010 , 27 , 402–409. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Gao, X.; Fujiwara, M.; Zhang, W.W.; Lin, P.C.; Liu, H.Z. The impact of dams on the population viability of a migratory fish in the Yangtze River, China. Aquat. Conserv. Mar. Freshw. Ecosyst. 2022 , 32 , 1509–1519. [ Google Scholar ] [ CrossRef ]
Xiong, M.H.; Shao, K.; Li, W.T.; Zhu, B. Research progress on resources variation and protection of Coreius guichenoti . Yangtze River 2023 , 54 , 63–71. (In Chinese) [ Google Scholar ]
Liao, X.; Yu, X.; Chang, J.B.; Tong, J. Polymorphic microsatellites in largemouth bronze gudgeon ( Coreius guichenoti ) developed from repeat-enriched libraries and cross-species amplifications. Mol. Ecol. Notes 2007 , 7 , 1104–1107. [ Google Scholar ] [ CrossRef ]
Zhao, J.H.; Zhu, Y.J.; He, Y.F.; Chen, J.W.; Feng, Y.B.; Li, X.; Xiong, B.X.; Yang, D.G. Effects of Temperature Reduction and MS-222 on Water Quality and Blood Biochemistry in Simulated Transport Experiment of Largemouth Bronze Gudgeon, Coreius guichenoti . J. World Aquac. Soc. 2014 , 45 , 493–507. [ Google Scholar ] [ CrossRef ]
Zhu, J.; Zhao, Y.; Yang, J.; Li, Y.; Chen, P.; Qu, H.T. Feeding frequency affects liver health in largemouth bronze gudgeon Coreius guichenoti : Implications for lipid metabolism, oxidative stress, and inflammation response. Aquac. Rep. 2024 , 35 , 101941. [ Google Scholar ] [ CrossRef ]
Bu, X.; Lian, X.; Zhang, Y.; Yang, C.; Cui, C.; Che, J.; Tang, B.; Su, B.; Zhou, Q.; Yang, Y. Effects of feeding rates on growth, feed utilization, and body composition of juvenile Pseudobagrus ussuriensis . Aquac. Int. 2017 , 25 , 1821–1831. [ Google Scholar ] [ CrossRef ]
Liu, W.; Wen, H.; Jiang, M.; Wu, J.J.; Wu, F. Effects of feeding rate and feeding frequency on growth performance and liver health for juvenile generically improved farmed tiplapid, Oreochromis Niloticus . Freshw. Fish. 2019 , 49 , 84–93. (In Chinese) [ Google Scholar ]
Liu, K.; He, J.Z.; Feng, P.F.; Ma, H.W.; Luo, X. Effects of feeding frequency and level on the digestive enzymes and fat metabolism enzyme in the hepatopancreas of juvenile Leiocassis longirostris . J. Yunnan Agric. Univ. (Nat. Sci.) 2019 , 34 , 779–784. (In Chinese) [ Google Scholar ]
He, B.; Zhou, B.; Xie, H.; Hu, Z.T.; Wang, B.; Zhang, J.L.; Li, Q.; Zhao, F.; Liu, X.; Li, Q. Effect of feeding level on growth, digestive and metabolic enzymes and antioxidant capacity in juvenile Yangtze sturgeon ( Acipenser dabryanus ). Aquaculture 2023 , 567 , 739265. [ Google Scholar ] [ CrossRef ]
Escriva, F.; Gavete, M.L.; Fermin, Y.; Pérez, C.; Carrascosa, J.M. Effect of age and moderate food restriction on insulin sensitivity in Wistar rats: Role of adiposity. J. Endocrinol. 2007 , 194 , 131–141. [ Google Scholar ] [ CrossRef ]
Desai, A.S.; Singh, R.K. The effects of water temperature and ration size on growth and body composition of fry of common carp, Cyprinus carpio . J. Therm. Biol. 2009 , 34 , 276–280. [ Google Scholar ] [ CrossRef ]
Greene, D.H.; Selivonchick, D.P. Lipid metabolism in fish. Prog. Lipid Res. 1987 , 26 , 53–85. [ Google Scholar ] [ CrossRef ]
Polakof, S.; Panserat, S.; Soengas, J.L.; Moon, T.W. Glucose metabolism in fish: A review. J. Comp. Physiol. B 2012 , 182 , 1015–1045. [ Google Scholar ] [ CrossRef ]
Enes, P.; Panserat, S.; Kaushik, S.; Oliva-Teles, A. Effect of normal and waxy maize starch on growth, food utilization and hepatic glucose metabolism in European sea bass ( Dicentrarchus labrax ) juveniles. Comp. Biochem. Physiol. A-Mol. Integr. Physiol. 2006 , 143 , 89–96. [ Google Scholar ] [ CrossRef ]
Wu, B.; Luo, Y.P.; Xie, X.J. Chemical composition and energy density in juvenile Coreius guichenoti . J. Southwest Univ. (Nat. Sci.) 2008 , 30 , 62–67. (In Chinese) [ Google Scholar ]
Dong, C.; Luo, A.H.; Chen, X.J.; Wang, C.Y.; Tan, H.Y.; Yang, Z. Nutrient composition analysis of Coreius guichenoti at different ages and gonad development stages. J. Hydroecology 2022 , 43 , 108–115. (In Chinese) [ Google Scholar ]
Liu, F.; Dang, S.G.; Wang, W.J.; Cao, W.X. Feeding habits of Coreius guichenoti (Sauvage et Dabry) in the upper Yangtze River. Acta Hydrobiol. Sin. 2012 , 36 , 1081–1086. (In Chinese) [ Google Scholar ] [ CrossRef ]
Zhao, Y.; Qu, H.T.; Chen, P.; Lu, X.B.; Guo, B.F.; Wen, Z.H. Effects of feeding strategy on growth, digestive enzymes, and liver structure in juvenile Coreius guichienoti . Prog. Fish. Sci. 2024 , 45 , 95–104. (In Chinese) [ Google Scholar ]
Chen, P.; Zhao, Y.; Yang, Y.J.; Yang, J.; Qu, H.T. Effects of high feeding rate on hepatic antioxidant, immune function and lipid metabolism in juvenile largemouth bronze gudgeon ( Coreius guichenoti ). Chin. J. Anim. Nutr. 2023 , 35 , 5870–5885. (In Chinese) [ Google Scholar ]
Chen, P.; Zhu, Y.P.; Wu, X.F.; Gu, X.; Xue, M.; Liang, X.F. Metabolic adaptation to high-starch diet in largemouth bass ( Micropterus salmoides ) was associated with the restoration of metabolic functions via inflammation, bile acid synthesis and energy metabolism. Br. J. Nutr. 2023 , 129 , 381–394. [ Google Scholar ] [ CrossRef ]
Wang, Y.; Kong, L.J.; Li, K.; Bureau, D.P. Effects of feeding frequency and ration level on growth, feed utilization and nitrogen waste output of cuneate drum ( Nibea miichthioides ) reared in net pens. Aquaculture 2007 , 271 , 350–356. [ Google Scholar ] [ CrossRef ]
Lupatsch, I.; Santos, G.A.; Schrama, J.W.; Verreth, J.A.J. Effect of stocking density and feeding level on energy expenditure and stress responsiveness in European sea bass Dicentrarchus labrax . Aquaculture 2010 , 298 , 245–250. [ Google Scholar ] [ CrossRef ]
Li, X.M.; Wu, X.B.; Gong, J.L.; Zhu, Y.J.; Yang, D.G. Comparative analysis of liver transcriptome of parent and offspring Coreius guichenoti . Acta Hydrobiol. Sin. 2020 , 44 , 774–780. (In Chinese) [ Google Scholar ]
Chen, P.; Yang, J.; Zhao, Y.; Qu, H.T. Analysis of fatty liver phenotype in juvenile largemouth bronze gudgeon on based on transcriptome sequencing. China Feed 2024 , 11 , 121–128. (In Chinese) [ Google Scholar ]
Liu, Y.; Wang, Y.J.; Tian, X.E.; Huang, X. Effect of ration levels on growth, feed utilization efficiency and body biochemical composition of Misgurnus anguillicaudatus . Feed Ind. 2011 , 32 , 26–28. (In Chinese) [ Google Scholar ]
Wei, Y.L.; Wang, J.X.; Xu, H.G.; Liang, M.Q. Study on optimum feeding frequency and feeding level of juvenile Takifugu rubripes . Chin. J. Anim. Nutr. 2021 , 33 , 1755–1765. (In Chinese) [ Google Scholar ]
Han, H.S.; Kang, G.; Kim, J.S.; Choi, B.H.; Koo, S.H. Regulation of glucose metabolism from a liver-centric perspective. Exp. Mol. Med. 2016 , 48 , e218. [ Google Scholar ] [ CrossRef ]
Wu, S.S.; Deng, Y.; Huo, H.H.; Peng, M. Research progress on glucose transporter 4 in glucose metabolism in fish: A review. Chin. J. Fish. 2023 , 5 , 138–147. (In Chinese) [ Google Scholar ]
Zhao, N.N.; Cui, Y.T.; Wang, Z.K.; Wang, C.; Zhang, Z.H.; Deng, Z.T.; Zhao, R.Y.; Sun, J.F.; Wang, R.J.; Li, Y.Q. Effects of feeding frequency on expression of genes related to metabolism and PI3K signaling pathway in Litopenaeus vannamei . Oceanol. Et Limnol. Sin. 2022 , 5 , 1189–1196. (In Chinese) [ Google Scholar ]
Yang, L.P.; Zhi, S.Y.; Yang, G.K.; Qin, C.B.; Yan, X.; Niu, M.M.; Zhang, W.L.; Liu, M.Y.; Zhao, M.J.; Nie, G.X. Molecular identification of glucose transporter 4: The responsiveness to starvation, glucose, insulin and glucagon on glucose transporter 4 in common carp ( Cyprinus carpio L.). J. Fish Biol. 2021 , 99 , 1843–1856. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Ma, H.J.; Mou, M.M.; Pu, D.C.; Lin, S.M.; Chen, Y.J.; Luo, L. Effect of dietary starch level on growth, metabolism enzyme and oxidative status of juvenile largemouth bass, Micropterus Salmoides . Aquac. 2019 , 498 , 482–487. [ Google Scholar ] [ CrossRef ]
Panserat, S.; Plagnes-Juan, E.; Kaushik, S. Nutritional regulation and tissue specificity of gene expression for proteins involved in hepatic glucose metabolism in rainbow trout ( Oncorhynchus mykiss ). J. Exp. Biol. 2001 , 204 , 2351–2360. [ Google Scholar ] [ CrossRef ] [ PubMed ]

Click here to enlarge figure

Genes	Forward Primer (5′-3′)	Reverse Primer (5′-3′)	Products (bp)
ef1α	TGGGTGTTGGACAAACTGAA	CAACACCACCAGCAACAATC	190
gk	GTCCCCATATCAGGGTGTCTT	CAACCGTTGTCAGAAGTCCAT	163
pk	ACTGGACACCAAAGGACCAG	GCTGGGATAATCCAACCAGA	157
pfkl	AGACTGCAGAAAGGGCAAAA	TTCTCTGCGGAAGGTCTTGT	154
pepck	ACCTGCACCTGGAATCAAAC	ACACACCATGACGCCAGTTA	236
g6p	TTCTCGTCTCTGAACCGTGAT	GAACAGTGGGAAGAGGGAAAC	163
glut2	CAGTTGCAACACCCAGCTAA	GGGCAGACGAACTCTCACTC	243
glut4	CCATGCCAATGATGAAGTTG	TGACAGGAGACTGTGCCATC	193
gysl	TTGCATAAATGGCCCTCTTC	CCTGCCAAAACCAACAACTT	199
pygl	TCTTTGACCAGCGTGAAGTG	CTCGGTGTAACCGGTGATCT	153

	Feeding Rates (%)				ANOVA p Value
	2	3	4	5	ANOVA p Value
initial body weight (g)	4.95 ± 0.12	5.01 ± 0.11	4.93 ± 0.08	4.98 ± 0.10	0.898
final body weight (g)	8.61 ± 0.26	10.68 ± 0.37	12.59 ± 0.43	14.17 ± 0.35	<0.001
WGR (%)	73.94 ± 4.23	113.17 ± 4.54	155.38 ± 5.32	184.54 ± 5.65	<0.001
SGR (%/d)	0.99 ± 0.08	1.35 ± 0.07	1.67 ± 0.08	1.86 ± 0.06	<0.001
FCR	0.46 ± 0.02	0.53 ± 0.01	0.55 ± 0.02	0.54 ± 0.01	0.012
CF (g/cm )	1.42 ± 0.10	1.49 ± 0.08	1.48 ± 0.08	1.45 ± 0.06	0.905
SR (%)	97.33 ± 0.67	98.67 ± 0.67	98.67 ± 1.33	96.67 ± 0.67	0.344

	Feeding Rates (%)				ANOVA p Value
	2	3	4	5	ANOVA p Value
Hematological parameters
Glucose (mmol/L)	4.82 ± 0.25	5.54 ± 0.45	6.82 ± 0.56	7.21 ± 0.56	0.018
Hepatic parameters
TP (g/L)	5.01 ± 0.31	4.15 ± 0.24	4.81 ± 0.45	4.61 ± 0.49	0.449
Glucose (mmol/g prot)	3.92 ± 0.14	4.68 ± 0.35	3.37 ± 0.65	3.25 ± 0.43	0.101
GK (U/g prot)	0.90 ± 0.19	1.03 ± 0.15	1.35 ± 0.12	1.33 ± 0.19	0.197
PFKL (U/g prot)	5.54 ± 0.47	6.68 ± 0.33	5.55 ± 0.57	7.64 ± 0.96	0.072
PK (U/g prot)	129.50 ± 15.22	141.05 ± 5.05	147.44 ± 21.32	210.60 ± 26.49	0.019
PC (U/g prot)	3.92 ± 0.24	4.43 ± 0.37	3.74 ± 0.35	4.93 ± 0.54	0.160
PEPCK (U/g prot)	4.83 ± 1.04	5.14 ± 0.35	5.87 ± 0.41	5.29 ± 0.44	0.666
G6P (U/mg prot)	159.45 ± 19.02	180.16 ± 19.21	199.36 ± 14.43	179.87 ± 21.13	0.543

The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

Chen, P.; Qu, H.; Yang, J.; Zhao, Y.; Cheng, X.; Jiang, W. Effects of Feeding Rates on Growth Performance and Liver Glucose Metabolism in Juvenile Largemouth Bronze Gudgeon ( Coreius guichenoti ). Animals 2024 , 14 , 2466. https://doi.org/10.3390/ani14172466

Chen P, Qu H, Yang J, Zhao Y, Cheng X, Jiang W. Effects of Feeding Rates on Growth Performance and Liver Glucose Metabolism in Juvenile Largemouth Bronze Gudgeon ( Coreius guichenoti ). Animals . 2024; 14(17):2466. https://doi.org/10.3390/ani14172466

Chen, Pei, Huantao Qu, Jing Yang, Yu Zhao, Xu Cheng, and Wei Jiang. 2024. "Effects of Feeding Rates on Growth Performance and Liver Glucose Metabolism in Juvenile Largemouth Bronze Gudgeon ( Coreius guichenoti )" Animals 14, no. 17: 2466. https://doi.org/10.3390/ani14172466

Article Metrics

Further information, mdpi initiatives, follow mdpi.

Subscribe to receive issue release notifications and newsletters from MDPI journals

IMAGES

CHICKEN LIVER AND HYDROGEN PEROXIDE EXPERIMENT
Liver experiment with hydrogen peroxide. Chicken Liver Enzyme Lab. 2022
The Effect of Hydrogen Peroxide on Liver: Hypothesis, Apparatus, Method
liver before and after being dropped into hydrogen peroxide solution
Liver And Hydrogen Peroxide Experiment
Liver and Hydrogen Peroxide (Chemical Reactions and Catalysts)

COMMENTS

Liver Enzymes and Hydrogen Peroxide
Extract a liver enzyme and use hydrogen peroxide to investigate activity in various conditions in this smelly science project.
Enzyme Lab
In this lab, you will study an enzyme that is found in the cells of many living tissues. The name of the enzyme is catalase; it speeds up a reaction which breaks down hydrogen peroxide, a toxic chemical, into 2 harmless substances--water and oxygen. Light can also break down H 2 O 2 which is why the chemical is sold in dark containers.
Testing for catalase enzymes
Try this class experiment to detect the presence of enzymes as they catalyse the decomposition of hydrogen peroxide. Includes kit list and safety instructions.
The Liver: Helping Enzymes Help You!
The liver uses specialized enzymes to help it break down toxic substances and make them safer for the body to process. But an enzyme, just like the chemical reactions it modifies, needs certain ...
Investigating Enzymes in Liver
This video explores how the enzyme "Catalase" in the liver breaks down Hydrogen Peroxide. This video demonstrates what happens when you "denature" or change ...
PDF Ch. 2 Design an Experiment: Investigating the Effect of Temperature on
Design Your Experiment Part A: Observe the Catalase Reaction 1. Place a small piece of raw liver in an open petri dish. Use a dropper pipette to put a drop of hydrogen peroxide solution on the liver. CAUTION: Hydrogen peroxide can be irritating to skin and eyes. If you spill any on yourself or your clothes, wash it off immediately and tell your ...
Enzyme Liver Lab
In this lab, you will study an enzyme that is found in the cells of many living tissues. The name of the enzyme is catalase (KAT-uh-LAYSS); it speeds up a reaction which breaks down hydrogen peroxide, a toxic chemical, into 2 harmless substances-water and oxygen. The reaction is: 2 H2O2 —-> 2 H2O + O2.
Hydrogen peroxide decomposition using different catalysts
From fresh liver, to powdered manganese, create different catalysts to explore the effervescent world of hydrogen peroxide decomposition Your shopping list might look strange, but this practical will be well worth it. Supporting student to understand reaction rates, catalysis, and enzymes. This experiment should take 5 minutes.
Investigating an enzyme-controlled reaction: catalase and hydrogen
Hydrogen peroxide is harmful and must be removed as soon as it is produced in the cell. Cells make the enzyme catalase to remove hydrogen peroxide. This investigation looks at the rate of oxygen production by the catalase in pureed potato as the concentration of hydrogen peroxide varies. The oxygen produced in 30 seconds is collected over water.
Liver Stinks!
This shows that the liver enzyme catalase is working to start the chemical reaction that breaks down the hydrogen peroxide that would be harmful to the body into less dangerous compounds. To test the effect of an acid on the liver enzyme, put one teaspoon of the blended liver in a bowl and mix it well with one teaspoon vinegar.
Catalase and Hydrogen Peroxide -How Do Enzymes Work?
StoryLab: How Enzymes Work This story lab aligns to an investigations students do with enzymes where they put hydrogen peroxide on liver and observe bubbles produced from the reaction with catalase.
LIVER LAB (ENZYME) EXPERIMENT
LIVER LAB (ENZYME) EXPERIMENT Background Info: Liver and other living tissues contain the enzyme catalase. This enzyme breaks down hydrogen peroxide, which is a harmful by-product of the process of cellular respiration if it builds up in concentration in the cells.
PDF Liver Enzyme Lab
Liver contains a specific enzyme called catalase. When hydrogen peroxide (H2O2) is added to liver, a chemical reaction occurs which results in the products of oxygen gas (O2) and liquid water (H2O). The purpose of this lab is to determine if changes in temperature will have an effect on the activity of an enzyme.
Top 7 Science Experiments with Hydrogen Peroxide
The Boiled Versus Fresh Liver with Hydrogen Peroxide experiment is a captivating and informative activity that students and teachers should consider trying. By comparing the reaction of hydrogen peroxide with boiled and fresh liver, students can explore the effects of heat on enzymatic activity.
Enzyme Science Fun
Last week Cordie thought up a fun liver and hydrogen peroxide enzyme experiment. The idea is an interesting extension of elephant toothpaste. And it extends the chemistry learning into biology (useful for homeschool records).
The Decomposition of Hydrogen Peroxide by Liver Catalase
1. The velocity of decomposition of hydrogen peroxide by catalase as a function of (a) concentration of catalase, (b) concentration of hydrogen peroxide, (c) hydrogen ion concentration, (d) temperature has been studied in an attempt to correlate these ...
Pre-lab: Liver and Enzyme activity
Watch this video prior to performing the liver/enzyme lab activity.
Living with Your Liver
Students learn the function of the liver and how biomedical engineers can use liver regeneration to help people. Students test the effects of toxic chemicals on a beef liver by adding hydrogen peroxide to various liver and salt solutions. They observe, record and graph their results.
Liver Lab
Liver Lab. Leaf Lab. The Effect of Hydrogen Peroxide and Temperature on the Rate of Enzyme Activity. Purpose: The purpose of this experiment was to determine the presence of enzymes in chicken liver based on the application and alteration of various conditions. Hypothesis: If only hydrogen peroxide is present, then the chicken liver will show ...
Liver and Hydrogen Peroxide Lab by Trent Nettles on Prezi
Liver and Hydrogen Peroxide Lab MAterials Why is 1 and 2 wrong? Hypothesis Explaination 1: There was a change in form of the hydrogen peroxide. The liver does not produce oxygen gas by itself. The liver will bubble because the liver is being placed into the hydrogen peroxide.
Liver and Hydrogen Peroxide experiment
See our A-Level Essay Example on Liver and Hydrogen Peroxide experiment, Molecules & Cells now at Marked By Teachers.
Lab Report 4: Enzyme Lab
Lab Report 4: Enzyme Lab. Abstract. We conducted labs over the course of two days to test catalase reactions and how a piece of chicken liver will interact with hydrogen peroxide. We put the chicken liver in multiple test tubes with different temperatures in each one. The temperatures being tested were hot (88 degrees Celcius), cold (3 degrees ...
Hydrogen Peroxide Breakdown in Liver vs. Potato
The liver contains more of the enzyme catalase, which breaks down hydrogen peroxide. The liver contains more because it detoxifies substances in the body. A larger amount of catalase lowers the activation energy, therefore speeds up the rate of reaction. The potato contains less of the enzyme catalase, therefore requires more activation energy ...
How Does the Liver Burn Fat? Study May Open Doors to New MASLD
Gerald Shulman, MD, PhD, is very concerned about the state of Americans' liver health.. Fatty liver disease, also known as metabolic dysfunction-associated steatotic liver disease, or MASLD, affects nearly 40% of U.S. adults and its prevalence is rising fast. "Fatty liver disease is becoming as important a problem as type 2 diabetes in some ways," said Shulman, George R. Cowgill ...
Far-infrared radiation alleviates steatohepatitis and fibrosis in
Metabolic dysfunction-associated fatty liver disease (MAFLD) is a disease that causes an abnormal accumulation of fat in the liver, triggering inflammation and fibrosis, the mechanism of which is ...
Effects of Feeding Rates on Growth Performance and Liver Glucose ...
The experiment was conducted to investigate the effects of feeding rates on growth performance, liver glycolysis, gluconeogenesis, glycogen synthesis, and glycogen decomposition in juvenile largemouth bronze gudgeon (Coreius guichenoti). A total number of 600 fish were randomly distributed into 12 cylindrical plastic tanks with 50 fish per tank and triplicate tanks per treatment.