clinical research study for endometriosis

Image credit: Shutterstock

Global study shows the experience of Endometriosis is rooted in genetics

Researchers at the University of Oxford, in collaboration with 25 teams across the world, have published the largest study to date of the genetic basis of endometriosis.

Their study included DNA from 60,600 women with endometriosis and 701,900 without. It revealed compelling evidence of a shared genetic basis for endometriosis and other types of pain seemingly unrelated to endometriosis, including migraine, back pain and multi-site pain. The study has also revealed that ovarian endometriosis has a different genetic basis from other disease manifestations. The results open up new avenues for designing new medical treatments targeting subtypes of endometriosis, or even the repurposing of existing pain treatments for endometriosis.

Endometriosis has enormous implications on the quality of a woman’s life. This severe inflammatory condition occurring in 5-10% of women of reproductive age (190 million globally) can cause constant and intense pelvic pain, fatigue, depression, anxiety, and infertility. It is characterized by the presence of tissue that resembles the uterus lining (endometrium) outside the uterus. The location of these endometriotic deposits is primarily on organs within the pelvis (e.g. ovaries, pelvic surfaces and ligaments, bowel or bladder), although more rarely it can also be found outside of the pelvis. The huge impact on the health of many women is compounded by the fact that endometriosis can only reliably be diagnosed through surgery and sometimes imaging, and often takes many years to diagnose (eight years on average from first symptoms). Treatment is limited to repeated surgeries, and hormonal treatments with many side-effects that do not allow women to get pregnant.

It is known that endometriosis can run in families, and therefore that genetic factors (heritability) play a role in how it develops in some women but not in others. Very little is known about the causes of endometriosis, and studying genetics - by comparing the DNA code in women with and without the disease - can give us clues to the biological processes that are the basis for onset and progression.

By conducting the largest genetic study ever conducted, the researchers found 42 areas across the genome that harbour variants that increase risk of endometriosis. By linking these variants to the profiles of molecules in endometrium and blood, they identified a range of genes that were differently expressed in these tissues and therefore had a likely role in disease development. This list of genes is important for further work to develop of new treatments, better targeted to subtypes of disease. For instance, they found that some genetic variants were more associated with ovarian ‘cystic’ endometriosis than superficial disease spread throughout the pelvis.

What they noted in particular is that many of the implicated genes play a role in pain perception and maintenance. Indeed, they found that there was a shared genetic basis for endometriosis and a range of other chronic pain types such migraine, back pain, and multi-site pain. This could be related to so-called sensitisation of the central nervous system, which makes individuals suffering from chronic pain more prone to other types of pain. These findings open up the possibility of designing new pain-focussed non-hormonal treatments, or repurposing existing pain treatments, for endometriosis.

Dr Nilufer Rahmioglu , Senior Research Scientist at the Wellcome Centre for Human Genetics , University of Oxford, and first author of the study commented: 'Using different datasets of women with and without endometriosis, some of which had unprecedented detailed data on surgical findings and pain experience collected using standardised criteria, allowed us to generate a treasure trove of new information about genetically driven endometriosis subtypes and pain experience.'

Professor Krina Zondervan , Co-Director of the Endometriosis CaRe Centre , and Head of the Nuffield Department of Women’s & Reproductive Health , University of Oxford, senior author on the paper, commented: 'Endometriosis is now recognised as a major health issue affecting women’s lives. This study involved the analysis of DNA from more than 60,000 women with endometriosis worldwide, in an unprecedented collaboration of 25 academic and industry groups contributing their data and time. It has provided a wealth of new knowledge on the genetics underlying endometriosis, which will help the research community in their efforts to come up with new treatments and possibly new ways of diagnosing the disease benefiting millions of women worldwide.'

The full paper, ' The genetic basis of endometriosis and comorbidity with other pain and inflammatory conditions ', is published in Nature Genetics .

DISCOVER MORE

• Support Oxford's research
• Partner with Oxford on research
• Study at Oxford
• Research jobs at Oxford

You can view all news or browse by category

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

• View all journals
• Explore content
• About the journal
• Publish with us
• Sign up for alerts
• Published: 19 July 2018

Endometriosis

• Krina T. Zondervan 1 , 2 ,
• Christian M. Becker 1 ,
• Kaori Koga 3 ,
• Stacey A. Missmer 4 , 5 ,
• Robert N. Taylor 6 &
• Paola Viganò 7  

Nature Reviews Disease Primers volume  4 , Article number:  9 ( 2018 ) Cite this article

22k Accesses

721 Citations

119 Altmetric

Metrics details

• Infertility
• Inflammation
• Reproductive disorders
• Reproductive techniques

Endometriosis is a common inflammatory disease characterized by the presence of tissue outside the uterus that resembles endometrium, mainly on pelvic organs and tissues. It affects ~5–10% of women in their reproductive years — translating to 176 million women worldwide — and is associated with pelvic pain and infertility. Diagnosis is reliably established only through surgical visualization with histological verification, although ovarian endometrioma and deep nodular forms of disease can be detected through ultrasonography and MRI. Retrograde menstruation is regarded as an important origin of the endometrial deposits, but other factors are involved, including a favourable endocrine and metabolic environment, epithelial–mesenchymal transition and altered immunity and inflammatory responses in genetically susceptible women. Current treatments are dictated by the primary indication (infertility or pelvic pain) and are limited to surgery and hormonal treatments and analgesics with many adverse effects that rarely provide long-term relief. Endometriosis substantially affects the quality of life of women and their families and imposes costs on society similar to those of other chronic conditions such as type 2 diabetes mellitus, Crohn’s disease and rheumatoid arthritis. Future research must focus on understanding the pathogenesis, identifying disease subtypes, developing non-invasive diagnostic methods and targeting non-hormonal treatments that are acceptable to women who wish to conceive.

This is a preview of subscription content, access via your institution

Access options

Access Nature and 54 other Nature Portfolio journals

Get Nature+, our best-value online-access subscription

24,99 € / 30 days

cancel any time

Subscribe to this journal

Receive 1 digital issues and online access to articles

111,21 € per year

only 111,21 € per issue

Buy this article

• Purchase on SpringerLink
• Instant access to full article PDF

Prices may be subject to local taxes which are calculated during checkout

Similar content being viewed by others

Rethinking mechanisms, diagnosis and management of endometriosis

Real world data on symptomology and diagnostic approaches of 27,840 women living with endometriosis

Endometriosis and chronic pelvic pain have similar impact on women, but time to diagnosis is decreasing: an Australian survey

Marsh, E. E. & Laufer, M. R. Endometriosis in premenarcheal girls who do not have an associated obstructive anomaly. Fertil. Steril. 83 , 758–760 (2005).

PubMed   Google Scholar  

Halme, J., Hammond, M. G., Hulka, J. F., Raj, S. G. & Talbert, L. M. Retrograde menstruation in healthy women and in patients with endometriosis. Obstet. Gynecol. 64 , 151–154 (1984).

CAS   PubMed   Google Scholar  

Horton, J. D., Dezee, K. J., Ahnfeldt, E. P. & Wagner, M. Abdominal wall endometriosis: a surgeon’s perspective and review of 445 cases. Am. J. Surg. 196 , 207–212 (2008).

Goldberg, J. & Davis, A. Extrapelvic endometriosis. Semin. Reprod. Med. 35 , 98–101 (2016).

Hirsch, M. et al. Diagnosis and management of endometriosis: a systematic review of international and national guidelines. BJOG 125 , 556–564 (2018).

American Society for Reproductive Medicine. Revised American Society for Reproductive Medicine classification of endometriosis: 1996. Fertil. Steril. 67 , 817–821 (1997).

Google Scholar  

Vercellini, P. et al. Association between endometriosis stage, lesion type, patient characteristics and severity of pelvic pain symptoms: a multivariate analysis of over 1000 patients. Hum. Reprod. 22 , 266–271 (2006).

Nnoaham, K. E. et al. Impact of endometriosis on quality of life and work productivity: a multicenter study across ten countries. Fertil. Steril. 96 , 366–373.e8 (2011). This paper presents the largest multicentre prospective study to date describing the effects of endometriosis; in women undergoing their first laparoscopy, a significantly reduced physical (but not mental) HRQOL, which was associated with delay in diagnosis, was reported in those with endometriosis compared with endometriosis-free symptomatic and asymptomatic women .

PubMed   PubMed Central   Google Scholar  

Peres, L. C. et al. Racial/ethnic differences in the epidemiology of ovarian cancer: a pooled analysis of 12 case-control studies. Int. J. Epidemiol. 47 , 460–472 (2018).

Eskenazi, B. & Warner, M. L. Epidemiology of endometriosis. Obstet. Gynecol. Clin. North Am. 24 , 235–258 (1997).

Buck Louis, G. M. et al. Incidence of endometriosis by study population and diagnostic method: the ENDO study. Fertil. Steril. 96 , 360–365 (2011).

Janssen, E. B., Rijkers, A. C. M., Hoppenbrouwers, K., Meuleman, C. & D’Hooghe, T. M. Prevalence of endometriosis diagnosed by laparoscopy in adolescents with dysmenorrhea or chronic pelvic pain: a systematic review. Hum. Reprod. Update 19 , 570–582 (2013).

Zondervan, K. T., Cardon, L. R. & Kennedy, S. H. What makes a good case–control study? Hum. Reprod. 17 , 1415–1423 (2002).

Adamson, G. D., Kennedy, S. & Hummelshoj, L. Creating solutions in endometriosis: global collaboration through the World Endometriosis Research Foundation. J. Endometr. Pelvic Pain Disord. 2 , 3–6 (2010).

Gemmell, L. C. et al. The management of menopause in women with a history of endometriosis: a systematic review. Hum. Reprod. Update 23 , 481–500 (2017).

CAS   PubMed   PubMed Central   Google Scholar  

Leibson, C. L. et al. Incidence and characterization of diagnosed endometriosis in a geographically defined population. Fertil. Steril. 82 , 314–321 (2004).

Missmer, S. A. Incidence of laparoscopically confirmed endometriosis by demographic, anthropometric, and lifestyle factors. Am. J. Epidemiol. 160 , 784–796 (2004).

Nnoaham, K. E., Webster, P., Kumbang, J., Kennedy, S. H. & Zondervan, K. T. Is early age at menarche a risk factor for endometriosis? A systematic review and meta-analysis of case-control studies. Fertil. Steril. 98 , 702–712.e6 (2012).

Missmer, S. A. et al. Reproductive history and endometriosis among premenopausal women. Obstet. Gynecol. 104 , 965–974 (2004).

Peterson, C. M. et al. Risk factors associated with endometriosis: importance of study population for characterizing disease in the ENDO Study. Am. J. Obstet. Gynecol. 208 , 451.e1–451.e11 (2013).

Prescott, J. et al. A prospective cohort study of endometriosis and subsequent risk of infertility. Hum. Reprod. 31 , 1475–1482 (2016).

Buck Louis, G. M. et al. Women’s reproductive history before the diagnosis of incident endometriosis. J. Womens Health 25 , 1021–1029 (2016).

Farland, L. V. et al. History of breast feeding and risk of incident endometriosis: prospective cohort study. BMJ 358 , j3778 (2017).

Leeners, B., Damaso, F., Ochsenbein-Kölble, N. & Farquhar, C. The effect of pregnancy on endometriosis — facts or fiction? Hum. Reprod. Update 24 , 290–299 (2018).

Shah, D. K., Correia, K. F., Vitonis, A. F. & Missmer, S. A. Body size and endometriosis: results from 20 years of follow-up within the Nurses’ Health Study II prospective cohort. Hum. Reprod. 28 , 1783–1792 (2013).

Farland, L. V. et al. Associations among body size across the life course, adult height and endometriosis. Hum. Reprod. 32 , 1732–1742 (2017).

McCann, S. E. et al. Endometriosis and body fat distribution. Obstet. Gynecol. 82 , 545–549 (1993).

Rahmioglu, N. et al. Genome-wide enrichment analysis between endometriosis and obesity-related traits reveals novel susceptibility loci. Hum. Mol. Genet. 24 , 1185–1199 (2015).

de Ridder, C. M. et al. Body fat mass, body fat distribution, and plasma hormones in early puberty in females. J. Clin. Endocrinol. Metab. 70 , 888–893 (1990).

Cramer, D. W. The relation of endometriosis to menstrual characteristics, smoking, and exercise. JAMA 255 , 1904–1908 (1986).

Baron, J. A., La Vecchia, C. & Levi, F. The antiestrogenic effect of cigarette smoking in women. Am. J. Obstet. Gynecol. 162 , 502–514 (1990).

Ohtake, F., Fujii-Kuriyama, Y., Kawajiri, K. & Kato, S. Cross-talk of dioxin and estrogen receptor signals through the ubiquitin system. J. Steroid Biochem. Mol. Biol. 127 , 102–107 (2011).

Parazzini, F. Selected food intake and risk of endometriosis. Hum. Reprod. 19 , 1755–1759 (2004).

Trabert, B., Peters, U., De Roos, A. J., Scholes, D. & Holt, V. L. Diet and risk of endometriosis in a population-based case–control study. Br. J. Nutr. 105 , 459–467 (2010).

Missmer, S. A. et al. A prospective study of dietary fat consumption and endometriosis risk. Hum. Reprod. 25 , 1528–1535 (2010).

Savaris, A. L. & do Amaral, V. F. Nutrient intake, anthropometric data and correlations with the systemic antioxidant capacity of women with pelvic endometriosis. Eur. J. Obstet. Gynecol. Reprod. Biol. 158 , 314–318 (2011).

Mozaffarian, D. et al. Dietary intake of trans fatty acids and systemic inflammation in women. Am. J. Clin. Nutr. 79 , 606–612 (2004).

Lebovic, D. I., Mueller, M. D. & Taylor, R. N. Immunobiology of endometriosis. Fertil. Steril. 75 , 1–10 (2001).

Rier, S. E. et al. Endometriosis in rhesus monkeys (Macaca mulatta) following chronic exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol. Sci. 21 , 433–441 (1993).

CAS   Google Scholar  

Smarr, M. M., Kannan, K. & Buck Louis, G. M. Endocrine disrupting chemicals and endometriosis. Fertil. Steril. 106 , 959–966 (2016).

Kvaskoff, M. et al. Endometriosis: a high-risk population for major chronic diseases? Hum. Reprod. Update 21 , 500–516 (2015). This article presents a meta-analysis of all data and a critical methodologic review suggesting that patients with endometriosis are at higher risk of ovarian and breast cancers, cutaneous melanoma, asthma and some autoimmune, cardiovascular and atopic diseases and are at decreased risk of cervical cancer .

Benagiano, G., Brosens, I. & Habiba, M. Structural and molecular features of the endomyometrium in endometriosis and adenomyosis. Hum. Reprod. Update 20 , 386–402 (2014).

Kunz, G. et al. Adenomyosis in endometriosis — prevalence and impact on fertility. Evidence from magnetic resonance imaging. Hum. Reprod. 20 , 2309–2316 (2005).

Pearce, C. L. et al. Association between endometriosis and risk of histological subtypes of ovarian cancer: a pooled analysis of case–control studies. Lancet Oncol. 13 , 385–394 (2012).

Kim, H. S., Kim, T. H., Chung, H. H. & Song, Y. S. Risk and prognosis of ovarian cancer in women with endometriosis: a meta-analysis. Br. J. Cancer 110 , 1878–1890 (2014).

Farland, L. V. et al. Endometriosis and the risk of skin cancer: a prospective cohort study. Cancer Causes Control 28 , 1011–1019 (2017).

Sinaii, N. High rates of autoimmune and endocrine disorders, fibromyalgia, chronic fatigue syndrome and atopic diseases among women with endometriosis: a survey analysis. Hum. Reprod. 17 , 2715–2724 (2002).

Nielsen, N. M., Jorgensen, K. T., Pedersen, B. V., Rostgaard, K. & Frisch, M. The co-occurrence of endometriosis with multiple sclerosis, systemic lupus erythematosus and Sjogren syndrome. Hum. Reprod. 26 , 1555–1559 (2011).

Harris, H. R. et al. Endometriosis and the risks of systemic lupus erythematosus and rheumatoid arthritis in the Nurses’ Health Study II. Ann. Rheum. Dis. 75 , 1279–1284 (2015).

Mu, F. et al. Association between endometriosis and hypercholesterolemia or hypertensionnovelty and significance. Hypertension 70 , 59–65 (2017).

Nyholt, D. R. et al. Genome-wide association meta-analysis identifies new endometriosis risk loci. Nat. Genet. 44 , 1355–1359 (2012).

Borghese, B., Zondervan, K. T., Abrao, M. S., Chapron, C. & Vaiman, D. Recent insights on the genetics and epigenetics of endometriosis. Clin. Genet. 91 , 254–264 (2017).

Treloar, S. A. et al. Genomewide linkage study in 1,176 affected sister pair families identifies a significant susceptibility locus for endometriosis on chromosome 10q26. Am. J. Hum. Genet. 77 , 365–376 (2005).

Zondervan, K. T. et al. Significant evidence of one or more susceptibility loci for endometriosis with near-Mendelian inheritance on chromosome 7p13–15. Hum. Reprod. 22 , 717–728 (2006).

Rahmioglu, N., Montgomery, G. W. & Zondervan, K. T. Genetics of endometriosis. Womens Health 11 , 577–586 (2015).

Sapkota, Y. et al. Meta-analysis identifies five novel loci associated with endometriosis highlighting key genes involved in hormone metabolism. Nat. Commun. 8 , 15539 (2017).

Lee, S. H. et al. Estimation and partitioning of polygenic variation captured by common SNPs for Alzheimer’s disease, multiple sclerosis and endometriosis. Hum. Mol. Genet. 22 , 832–841 (2012).

Uimari, O. et al. Genome-wide genetic analyses highlight mitogen-activated protein kinase (MAPK) signaling in the pathogenesis of endometriosis. Hum. Reprod. 32 , 780–793 (2017).

Lu, Y. et al. Shared genetics underlying epidemiological association between endometriosis and ovarian cancer. Hum. Mol. Genet. 24 , 5955–5964 (2015).

Painter, J. N. et al. Genetic overlap between endometriosis and endometrial cancer: evidence from cross-disease genetic correlation and GWAS meta-analyses. Cancer Med. 7 , 1978–1987 (2018).

Sapkota, Y. et al. Analysis of potential protein-modifying variants in 9000 endometriosis patients and 150000 controls of European ancestry. Sci. Rep. 7 , 11380 (2017).

Visscher, P. M., Brown, M. A., McCarthy, M. I. & Yang, J. Five years of GWAS discovery. Am. J. Hum. Genet. 90 , 7–24 (2012).

Fung, J. N. et al. The genetic regulation of transcription in human endometrial tissue. Hum. Reprod. 32 , 1–12 (2017).

Becker, C. M. et al. World Endometriosis Research Foundation Endometriosis Phenome and Biobanking Harmonisation Project: I. Surgical phenotype data collection in endometriosis research. Fertil. Steril. 102 , 1213–1222 (2014).

Vitonis, A. F. et al. World Endometriosis Research Foundation Endometriosis Phenome and Biobanking Harmonization Project: II. Clinical and covariate phenotype data collection in endometriosis research. Fertil. Steril. 102 , 1223–1232 (2014).

Rahmioglu, N. et al. World Endometriosis Research Foundation Endometriosis Phenome and Biobanking Harmonization Project: III. Fluid biospecimen collection, processing, and storage in endometriosis research. Fertil. Steril. 102 , 1233–1243 (2014).

Fassbender, A. et al. World Endometriosis Research Foundation Endometriosis Phenome and Biobanking Harmonisation Project: IV. Tissue collection, processing, and storage in endometriosis research. Fertil. Steril. 102 , 1244–1253 (2014).

Wiegand, K. C. et al. ARID1A mutations in endometriosis-associated ovarian carcinomas. N. Engl. J. Med. 363 , 1532–1543 (2010).

Yamamoto, S., Tsuda, H., Takano, M., Tamai, S. & Matsubara, O. Loss of ARID1A protein expression occurs as an early event in ovarian clear-cell carcinoma development and frequently coexists with PIK3CA mutations. Mod. Pathol. 25 , 615–624 (2011).

Anglesio, M. S. et al. Cancer-associated mutations in endometriosis without cancer. N. Engl. J. Med. 376 , 1835–1848 (2017).

Kato, S., Lippman, S. M., Flaherty, K. T. & Kurzrock, R. The conundrum of genetic ‘drivers’ in benign conditions. J. Natl Cancer Inst. 108 , djw036 (2016).

Guo, S.-W. Epigenetics of endometriosis. Mol. Hum. Reprod. 15 , 587–607 (2009).

Wu, Y., Starzinski-Powitz, A. & Guo, S.-W. Trichostatin A, a histone deacetylase inhibitor, attenuates invasiveness and reactivates E-cadherin expression in immortalized endometriotic cells. Reprod. Sci. 14 , 374–382 (2007).

Dyson, M. T. et al. Genome-wide DNA methylation analysis predicts an epigenetic switch for GATA factor expression in endometriosis. PLoS Genet. 10 , e1004158 (2014).

Burney, R. O. et al. MicroRNA expression profiling of eutopic secretory endometrium in women with versus without endometriosis. Mol. Hum. Reprod. 15 , 625–631 (2009).

Saare, M. et al. Challenges in endometriosis miRNA studies — from tissue heterogeneity to disease specific miRNAs. Biochim. Biophys. Acta 1863 , 2282–2292 (2017).

Sampson, J. A. Peritoneal endometriosis due to the menstrual dissemination of endometrial tissue into the peritoneal cavity. Am. J. Obstet. Gynecol. 14 , 422–469 (1927).

Vercellini, P. et al. Asymmetry in distribution of diaphragmatic endometriotic lesions: evidence in favour of the menstrual reflux theory. Hum. Reprod. 22 , 2359–2367 (2007).

D’Hooghe, T. M., Bambra, C. S., Raeymaekers, B. M. & Koninckx, P. R. Increased prevalence and recurrence of retrograde menstruation in baboons with spontaneous endometriosis. Hum. Reprod. 11 , 2022–2025 (1996).

Witz, C. A., Cho, S., Centonze, V. E., Montoya-Rodriguez, I. A. & Schenken, R. S. Time series analysis of transmesothelial invasion by endometrial stromal and epithelial cells using three-dimensional confocal microscopy. Fertil. Steril. 79 (Suppl. 1), 770–778 (2003).

Reis, F. M., Petraglia, F. & Taylor, R. N. Endometriosis: hormone regulation and clinical consequences of chemotaxis and apoptosis. Hum. Reprod. Update 19 , 406–418 (2013).

Sanchez, A. M. et al. The endometriotic tissue lining the internal surface of endometrioma: hormonal, genetic, epigenetic status, and gene expression profile. Reprod. Sci. 22 , 391–401 (2015).

Borghese, B., Zondervan, K. T., Abrao, M. S., Chapron, C. & Vaiman, D. Recent insights on the genetics and epigenetics of endometriosis. Clin. Genet. 91 , 254–264 (2016).

Meyer, R. Zur Frage der heterotopen Epithelwucherung, insbesondere des Peritonealepithels und in die Ovarien [German]. Virch Arch. Path. Anat. Phys. 250 , 595–610 (1924).

Ferguson, B. R., Bennington, J. L. & Haber, S. L. Histochemistry of mucosubstances and histology of mixed müllerian pelvic lymph node glandular inclusions. Evidence for histogenesis by müllerian metaplasia of coelomic epithelium. Obstet. Gynecol. 33 , 617–625 (1969).

Figueira, P. G. M., Abrão, M. S., Krikun, G. & Taylor, H. Stem cells in endometrium and their role in the pathogenesis of endometriosis. Ann. NY Acad. Sci. 1221 , 10–17 (2011).

Du, H. & Taylor, H. S. Contribution of bone marrow-derived stem cells to endometrium and endometriosis. Stem Cells 25 , 2082–2086 (2007).

Gargett, C. E. & Masuda, H. Adult stem cells in the endometrium. Mol. Hum. Reprod. 16 , 818–834 (2010).

Matsuzaki, S. & Darcha, C. Epithelial to mesenchymal transition-like and mesenchymal to epithelial transition-like processes might be involved in the pathogenesis of pelvic endometriosis. Hum. Reprod. 27 , 712–721 (2012).

Somigliana, E. et al. Association rate between deep peritoneal endometriosis and other forms of the disease: pathogenetic implications. Hum. Reprod. 19 , 168–171 (2004).

Zheng, W. et al. Initial endometriosis showing direct morphologic evidence of metaplasia in the pathogenesis of ovarian endometriosis. Int. J. Gynecol. Pathol. 24 , 164–172 (2005).

Troncon, J. K. et al. Endometriosis in a patient with mayer-rokitansky-küster-hauser syndrome. Case Rep. Obstet. Gynecol. 2014 , 376231 (2014).

Taguchi, S., Enomoto, Y. & Homma, Y. Bladder endometriosis developed after long-term estrogen therapy for prostate cancer. Int. J. Urol. 19 , 964–965 (2012).

Halban, J. Hysteroadenosis metastatica. Zentralbl. Gyndkoi 7 , 387–391 (1925).

Mechsner, S. et al. Estrogen and progestogen receptor positive endometriotic lesions and disseminated cells in pelvic sentinel lymph nodes of patients with deep infiltrating rectovaginal endometriosis: a pilot study. Hum. Reprod. 23 , 2202–2209 (2008).

Gargett, C. E. et al. Potential role of endometrial stem/progenitor cells in the pathogenesis of early-onset endometriosis. Mol. Hum. Reprod. 20 , 591–598 (2014).

Witz, C. A. et al. Short-term culture of peritoneum explants confirms attachment of endometrium to intact peritoneal mesothelium. Fertil. Steril. 75 , 385–390 (2001).

Zeitoun, K. M. & Bulun, S. E. Aromatase: a key molecule in the pathophysiology of endometriosis and a therapeutic target. Fertil. Steril. 72 , 961–969 (1999).

Pellegrini, C. et al. The expression of estrogen receptors as well as GREB1, c-MYC, and cyclin D1, estrogen-regulated genes implicated in proliferation, is increased in peritoneal endometriosis. Fertil. Steril. 98 , 1200–1208 (2012).

Plante, B. J. et al. G protein-coupled estrogen receptor (GPER) expression in normal and abnormal endometrium. Reprod. Sci. 19 , 684–693 (2012).

Han, S. J. et al. Estrogen receptor β modulates apoptosis complexes and the inflammasome to drive the pathogenesis of endometriosis. Cell 163 , 960–974 (2015).

Vercellini, P., Viganò, P., Somigliana, E. & Fedele, L. Endometriosis: pathogenesis and treatment. Nat. Rev. Endocrinol. 10 , 261–275 (2013). For this review, the best-quality evidence was selected to describe the performance of diagnostic tools and the effectiveness of approaches to address endometriosis-associated symptoms and infertility .

Patel, B. et al. Role of nuclear progesterone receptor isoforms in uterine pathophysiology. Hum. Reprod. Update 21 , 155–173 (2014).

Al-Sabbagh, M., Lam, E. W.-F. & Brosens, J. J. Mechanisms of endometrial progesterone resistance. Mol. Cell. Endocrinol. 358 , 208–215 (2012).

La Marca, A., Carducci Artenisio, A., Stabile, G., Rivasi, F. & Volpe, A. Evidence for cycle-dependent expression of follicle-stimulating hormone receptor in human endometrium. Gynecol. Endocrinol. 21 , 303–306 (2005).

Zondervan, K. et al. Beyond endometriosis genome-wide association study: from genomics to phenomics to the patient. Semin. Reprod. Med. 34 , 242–254 (2016).

Jiang, Y., Chen, L., Taylor, R. N., Li, C. & Zhou, X. Physiological and pathological implications of retinoid action in the endometrium. J. Endocrinol. 236 , R169–R188 (2018).

Orvis, G. D. & Behringer, R. R. Cellular mechanisms of Müllerian duct formation in the mouse. Dev. Biol. 306 , 493–504 (2007).

Vigano, P. et al. Time to redefine endometriosis including its pro-fibrotic nature. Hum. Reprod. 33 , 347–352 (2018).

Yu, J. et al. Endometrial stromal decidualization responds reversibly to hormone stimulation and withdrawal. Endocrinology 157 , 2432–2446 (2016).

Yin, X., Pavone, M. E., Lu, Z., Wei, J. & Kim, J. J. Increased activation of the PI3K/AKT pathway compromises decidualization of stromal cells from endometriosis. J. Clin. Endocrinol. Metab. 97 , E35–E43 (2012).

Du, Y., Liu, X. & Guo, S.-W. Platelets impair natural killer cell reactivity and function in endometriosis through multiple mechanisms. Hum. Reprod. 32 , 1–17 (2017).

Lessey, B., Lebovic, D. & Taylor, R. Eutopic endometrium in women with endometriosis: ground zero for the study of implantation defects. Semin. Reprod. Med. 31 , 109–124 (2013).

Cominelli, A. et al. Matrix metalloproteinase-27 is expressed in CD163+/CD206+ M2 macrophages in the cycling human endometrium and in superficial endometriotic lesions. Mol. Hum. Reprod. 20 , 767–775 (2014).

Takebayashi, A. et al. Subpopulations of macrophages within eutopic endometrium of endometriosis patients. Am. J. Reprod. Immunol. 73 , 221–231 (2015).

Nisenblat, V. et al. Blood biomarkers for the non-invasive diagnosis of endometriosis. Cochrane Database Syst. Rev. 5 , CD012179 (2016).

Wang, X.-Q. et al. The high level of RANTES in the ectopic milieu recruits macrophages and induces their tolerance in progression of endometriosis. J. Mol. Endocrinol. 45 , 291–299 (2010).

McKinnon, B. D., Kocbek, V., Nirgianakis, K., Bersinger, N. A. & Mueller, M. D. Kinase signalling pathways in endometriosis: potential targets for non-hormonal therapeutics. Hum. Reprod. Update 22 , 382–403 (2016).

Morotti, M., Vincent, K. & Becker, C. M. Mechanisms of pain in endometriosis. Eur. J. Obstet. Gynecol. Reprod. Biol. 209 , 8–13 (2017).

Berkley, K. J. The pains of endometriosis. Science 308 , 1587–1589 (2005).

Taylor, R. N. & Lebovic, D. I. in Yen and Jaffe’s Reproductive Endocrinology (eds Strauss, J. F. & Barbieri, R. L.) 565–585 (Saunders Elsevier, 2014). This book chapter discusses the diagnosis and management of endometriosis, with a particularly well-referenced review of theories of aetiology and pathogenesis

Gnecco, J. S. et al. Compartmentalized culture of perivascular stroma and endothelial cells in a microfluidic model of the human endometrium. Ann. Biomed. Eng. 45 , 1758–1769 (2017).

Sanchez, A. M. et al. The endometriotic tissue lining the internal surface of endometrioma. Reprod. Sci. 22 , 391–401 (2014).

Ryan, I. P., Schriock, E. D. & Taylor, R. N. Isolation, characterization, and comparison of human endometrial and endometriosis cells in vitro. J. Clin. Endocrinol. Metab. 78 , 642–649 (1994).

Greaves, E., Critchley, H. O. D., Horne, A. W. & Saunders, P. T. K. Relevant human tissue resources and laboratory models for use in endometriosis research. Acta Obstet. Gynecol. Scand. 96 , 644–658 (2017).

Korch, C. et al. DNA profiling analysis of endometrial and ovarian cell lines reveals misidentification, redundancy and contamination. Gynecol. Oncol. 127 , 241–248 (2012).

Grümmer, R. Translational animal models to study endometriosis-associated infertility. Semin. Reprod. Med. 31 , 125–132 (2013). Given the ethical limitations of clinical studies, this is a comprehensive review of the use of animal models to investigate factors contributing to the fertility-compromising effects of endometriosis .

Bruner-Tran, K. L., McConaha, M. E. & Osteen, K. G. in Endometriosis. Science and Practice (eds Giudice, L. C., Evers, J. L. H. & Healy, D. L.) 270–283 (Wiley-Blackwell, 2012).

Mariani, M. et al. The selective vitamin D receptor agonist, elocalcitol, reduces endometriosis development in a mouse model by inhibiting peritoneal inflammation. Hum. Reprod. 27 , 2010–2019 (2012).

Fazleabas, A. in Endometriosis: Science and Practice (eds Giudice, L. C., Evers, J. L. & Healy, D. L.) 285–291 (Wiley-Blackwell, 2012).

Ngô, C. et al. Antiproliferative effects of anastrozole, methotrexate, and 5-fluorouracil on endometriosis in vitro and in vivo. Fertil. Steril. 94 , 1632–1638.e1 (2010).

Bruner-Tran, K. L., Osteen, K. G. & Duleba, A. J. Simvastatin protects against the development of endometriosis in a nude mouse model. J. Clin. Endocrinol. Metab. 94 , 2489–2494 (2009).

Pullen, N. et al. The translational challenge in the development of new and effective therapies for endometriosis: a review of confidence from published preclinical efficacy studies. Hum. Reprod. Update 17 , 791–802 (2011).

Greaves, E. et al. A novel mouse model of endometriosis mimics human phenotype and reveals insights into the inflammatory contribution of shed endometrium. Am. J. Pathol. 184 , 1930–1939 (2014).

Stilley, J. A. W., Woods-Marshall, R., Sutovsky, M., Sutovsky, P. & Sharpe-Timms, K. L. Reduced fecundity in female rats with surgically induced endometriosis and in their daughters: a potential role for tissue inhibitors of metalloproteinase 11. Biol. Reprod. 80 , 649–656 (2009).

Zondervan, K. T. Familial aggregation of endometriosis in a large pedigree of rhesus macaques. Hum. Reprod. 19 , 448–455 (2004).

Lebovic, D. I. et al. Peroxisome proliferator-activated receptor-γ receptor ligand partially prevents the development of endometrial explants in baboons: a prospective, randomized, placebo-controlled study. Endocrinology 151 , 1846–1852 (2010).

D’Hooghe, T. M. Clinical relevance of the baboon as a model for the study of endometriosis. Fertil. Steril. 68 , 613–625 (1997).

Fazleabas, A. Progesterone resistance in a baboon model of endometriosis. Semin. Reprod. Med. 28 , 75–80 (2010).

D’Hooghe, T. M. et al. Nonhuman primate models for translational research in endometriosis. Reprod. Sci. 16 , 152–161 (2009).

Chapron, C. et al. Surgical complications of diagnostic and operative gynaecological laparoscopy: a series of 29,966 cases. Hum. Reprod. 13 , 867–872 (1998).

Chung, M. K., Chung, R. R., Gordon, D. & Jennings, C. The evil twins of chronic pelvic pain syndrome: endometriosis and interstitial cystitis. JSLS 6 , 311–314 (2002).

Redwine, D. B. Diaphragmatic endometriosis: diagnosis, surgical management, and long-term results of treatment. Fertil. Steril. 77 , 288–296 (2002).

Fedele, L. et al. Ileocecal endometriosis: clinical and pathogenetic implications of an underdiagnosed condition. Fertil. Steril. 101 , 750–753 (2014).

DiVasta, A. D., Vitonis, A. F., Laufer, M. R. & Missmer, S. A. Spectrum of symptoms in women diagnosed with endometriosis during adolescence versus adulthood. Am. J. Obstet. Gynecol. 218 , 324.e1–324.e11 (2018).

Ballard, K., Lane, H., Hudelist, G., Banerjee, S. & Wright, J. Can specific pain symptoms help in the diagnosis of endometriosis? A cohort study of women with chronic pelvic pain. Fertil. Steril. 94 , 20–27 (2010).

Becker, C. M., Gattrell, W. T., Gude, K. & Singh, S. S. Reevaluating response and failure of medical treatment of endometriosis: a systematic review. Fertil. Steril. 108 , 125–136 (2017).

Brawn, J., Morotti, M., Zondervan, K. T., Becker, C. M. & Vincent, K. Central changes associated with chronic pelvic pain and endometriosis. Hum. Reprod. Update 20 , 737–747 (2014).

Morotti, M., Vincent, K., Brawn, J., Zondervan, K. T. & Becker, C. M. Peripheral changes in endometriosis-associated pain. Hum. Reprod. Update 20 , 717–736 (2014).

Brosens, I., Gordts, S. & Benagiano, G. Endometriosis in adolescents is a hidden, progressive and severe disease that deserves attention, not just compassion. Hum. Reprod. 28 , 2026–2031 (2013).

Laufer, M. R., Sanfilippo, J. & Rose, G. Adolescent endometriosis: diagnosis and treatment approaches. J. Pediatr. Adolesc. Gynecol. 16 , S3–S11 (2003).

Davis, G. D., Thillet, E. & Lindemann, J. Clinical characteristics of adolescent endometriosis. J. Adolesc. Health 14 , 362–368 (1993).

Saraswat, L. et al. Pregnancy outcomes in women with endometriosis: a national record linkage study. BJOG 124 , 444–452 (2017).

Sanchez, A. M. et al. Is the oocyte quality affected by endometriosis? A review of the literature. J. Ovarian Res. 10 , 43 (2017).

Simón, C. et al. Outcome of patients with endometriosis in assisted reproduction: results from in-vitro fertilization and oocyte donation. Hum. Reprod. 9 , 725–729 (1994).

Senapati, S., Sammel, M. D., Morse, C. & Barnhart, K. T. Impact of endometriosis on in vitro fertilization outcomes: an evaluation of the Society for Assisted Reproductive Technologies Database. Fertil. Steril. 106 , 164–171.e1 (2016).

Taniguchi, F. et al. Analysis of pregnancy outcome and decline of anti-Müllerian hormone after laparoscopic cystectomy for ovarian endometriomas. J. Obstet. Gynaecol. Res. 42 , 1534–1540 (2016).

Lessey, B. A. & Kim, J. J. Endometrial receptivity in the eutopic endometrium of women with endometriosis: it is affected, and let me show you why. Fertil. Steril. 108 , 19–27 (2017).

Miravet-Valenciano, J., Ruiz-Alonso, M., Gómez, E. & Garcia-Velasco, J. A. Endometrial receptivity in eutopic endometrium in patients with endometriosis: it is not affected, and let me show you why. Fertil. Steril. 108 , 28–31 (2017).

Díaz, I. et al. Impact of stage iii–iv endometriosis on recipients of sibling oocytes: matched case-control study. Fertil. Steril. 74 , 31–34 (2000).

Prapas, Y. et al. History of endometriosis may adversely affect the outcome in menopausal recipients of sibling oocytes. Reprod. Biomed. Online 25 , 543–548 (2012).

Burney, R. O. et al. Gene expression analysis of endometrium reveals progesterone resistance and candidate susceptibility genes in women with endometriosis. Endocrinology 148 , 3814–3826 (2007).

Dunselman, G. A. J. et al. ESHRE guideline: management of women with endometriosis. Hum. Reprod. 29 , 400–412 (2014). This guideline discusses the management of general endometriosis .

Weijenborg, P. T. M., ter Kuile, M. M. & Jansen, F. W. Intraobserver and interobserver reliability of videotaped laparoscopy evaluations for endometriosis and adhesions. Fertil. Steril. 87 , 373–380 (2007).

Tuttlies, F. et al. ENZIAN-score, a classification of deep infiltrating endometriosis [German]. Zentralbl. Gynakol. 127 , 275–281 (2005).

Johnson, N. P. et al. World Endometriosis Society consensus on the classification of endometriosis. Hum. Reprod. 32 , 315–324 (2017).

Nisolle, M. & Donnez, J. Peritoneal endometriosis, ovarian endometriosis, and adenomyotic nodules of the rectovaginal septum are three different entities. Fertil. Steril. 68 , 585–596 (1997).

Fukuda, S. et al. Thoracic endometriosis syndrome: comparison between catamenial pneumothorax or endometriosis-related pneumothorax and catamenial hemoptysis. Eur. J. Obstet. Gynecol. Reprod. Biol. 225 , 118–123 (2018).

Rousset-Jablonski, C. et al. Catamenial pneumothorax and endometriosis-related pneumothorax: clinical features and risk factors. Hum. Reprod. 26 , 2322–2329 (2011).

Redwine, D. B. Ovarian endometriosis: a marker for more extensive pelvic and intestinal disease. Fertil. Steril. 72 , 310–315 (1999).

Hudelist, G. et al. Diagnostic accuracy of transvaginal ultrasound for non-invasive diagnosis of bowel endometriosis: systematic review and meta-analysis. Ultrasound Obstet. Gynecol. 37 , 257–263 (2011).

Holland, T. K. et al. Ultrasound mapping of pelvic endometriosis: does the location and number of lesions affect the diagnostic accuracy? A multicentre diagnostic accuracy study. BMC Womens Health 13 , 43 (2013).

Noventa, M. et al. Ultrasound techniques in the diagnosis of deep pelvic endometriosis: algorithm based on a systematic review and meta-analysis. Fertil. Steril. 104 , 366–383.e2 (2015).

Bazot, M. et al. European Society of Urogenital Radiology (ESUR) guidelines: MR imaging of pelvic endometriosis. Eur. Radiol. 27 , 2765–2775 (2016).

Exacoustos, C., Manganaro, L. & Zupi, E. Imaging for the evaluation of endometriosis and adenomyosis. Best Pract. Res. Clin. Obstet. Gynaecol. 28 , 655–681 (2014).

Stratton, P. Diagnostic accuracy of laparoscopy, magnetic resonance imaging, and histopathologic examination for the detection of endometriosis. Fertil. Steril. 79 , 1078–1085 (2003).

Kennedy, S. et al. ESHRE guideline for the diagnosis and treatment of endometriosis. Hum. Reprod. 20 , 2698–2704 (2005).

Wykes, C. B., Clark, T. J. & Khan, K. S. REVIEW: Accuracy of laparoscopy in the diagnosis of endometriosis: a systematic quantitative review. BJOG 111 , 1204–1212 (2004).

Balasch, J. et al. Visible and non-visible endometriosis at laparoscopy in fertile and infertile women and in patients with chronic pelvic pain: a prospective study. Hum. Reprod. 11 , 387–391 (1996).

Lessey, B. A., Higdon, H. L., Miller, S. E. & Price, T. A. Intraoperative detection of subtle endometriosis: a novel paradigm for detection and treatment of pelvic pain associated with the loss of peritoneal integrity. J. Vis. Exp. https://doi.org/10.3791/4313 (2012).

Lue, J. R., Pyrzak, A. & Allen, J. Improving accuracy of intraoperative diagnosis of endometriosis: role of firefly in minimal access robotic surgery. J. Minim. Access Surg. 12 , 186–189 (2016).

Practice Committee of American Society for Reproductive Medicine. Treatment of pelvic pain associated with endometriosis. Fertil. Steril. 90 , S260–S269 (2008). This article is a guideline for the management of pelvic pain associated with endometriosis .

Duffy, J. M. N. et al. Laparoscopic surgery for endometriosis. Cochrane Database Syst. Rev. 4 , CD011031 (2014).

Practice Committee of the American Society for Reproductive Medicine. Endometriosis and infertility: a committee opinion. Fertil. Steril. 98 , 591–598 (2012). This paper is a guideline for the management of infertility associated with endometriosis .

Tanbo, T. & Fedorcsak, P. Endometriosis-associated infertility: aspects of pathophysiological mechanisms and treatment options. Acta Obstet. Gynecol. Scand. 96 , 659–667 (2017).

Osuga, Y. et al. Role of laparoscopy in the treatment of endometriosis-associated infertility. Gynecol. Obstet. Invest. 53 , 33–39 (2002).

Hart, R. J., Hickey, M., Maouris, P., Buckett, W. & Garry, R. Excisional surgery versus ablative surgery for ovarian endometriomata. Cochrane Database Syst. Rev. https://doi.org/10.1002/14651858.CD004992.pub2 (2005).

Benaglia, L. et al. Rate of severe ovarian damage following surgery for endometriomas. Hum. Reprod. 25 , 678–682 (2010).

Vercellini, P. et al. Effect of patient selection on estimate of reproductive success after surgery for rectovaginal endometriosis: literature review. Reprod. Biomed. Online 24 , 389–395 (2012).

Nyangoh Timoh, K., Ballester, M., Bendifallah, S., Fauconnier, A. & Darai, E. Fertility outcomes after laparoscopic partial bladder resection for deep endometriosis: retrospective analysis from two expert centres and review of the literature. Eur. J. Obstet. Gynecol. Reprod. Biol. 220 , 12–17 (2018).

Adamson, G. D. & Pasta, D. J. Endometriosis fertility index: the new, validated endometriosis staging system. Fertil. Steril. 94 , 1609–1615 (2010).

Werbrouck, E., Spiessens, C., Meuleman, C. & D’Hooghe, T. No difference in cycle pregnancy rate and in cumulative live-birth rate between women with surgically treated minimal to mild endometriosis and women with unexplained infertility after controlled ovarian hyperstimulation and intrauterine insemination. Fertil. Steril. 86 , 566–571 (2006).

National Institute for Health and Care Excellence. Fertility problems: assessment and treatment. NICE https://www.nice.org.uk/guidance/cg156/chapter/Recommendations#intrauterine-insemination (2013).

de Ziegler, D., Borghese, B. & Chapron, C. Endometriosis and infertility: pathophysiology and management. Lancet 376 , 730–738 (2010).

Steures, P. et al. Prediction of an ongoing pregnancy after intrauterine insemination. Fertil. Steril. 82 , 45–51 (2004).

Reindollar, R. H. et al. A randomized clinical trial to evaluate optimal treatment for unexplained infertility: the fast track and standard treatment (FASTT) trial. Fertil. Steril. 94 , 888–899 (2010).

Eijkemans, M. J. C. et al. Cost-effectiveness of ‘immediate IVF’ versus ‘delayed IVF’: a prospective study. Hum. Reprod. 32 , 999–1008 (2017).

Hamdan, M., Omar, S. Z., Dunselman, G. & Cheong, Y. Influence of endometriosis on assisted reproductive technology outcomes. Obstet. Gynecol. 125 , 79–88 (2015).

Benschop, L., Farquhar, C., van der Poel, N. & Heineman, M. J. Interventions for women with endometrioma prior to assisted reproductive technology. Cochrane Database Syst. Rev. 11 , CD008571 (2010).

de Ziegler, D. et al. Use of oral contraceptives in women with endometriosis before assisted reproduction treatment improves outcomes. Fertil. Steril. 94 , 2796–2799 (2010).

Donnez, J., García-Solares, J. & Dolmans, M.-M. Fertility preservation in women with ovarian endometriosis. Minerva Ginecol. https://doi.org/10.23736/S0026-4784.18.04229-6 (2018).

Somigliana, E. et al. Surgical excision of endometriomas and ovarian reserve: a systematic review on serum antimüllerian hormone level modifications. Fertil. Steril. 98 , 1531–1538 (2012).

Bianchi, P. H. M. et al. Extensive excision of deep infiltrative endometriosis before in vitro fertilization significantly improves pregnancy rates. J. Minim. Invasive Gynecol. 16 , 174–180 (2009).

Zullo, F. et al. Endometriosis and obstetrics complications: a systematic review and meta-analysis. Fertil. Steril. 108 , 667–672.e5 (2017).

Vigano, P., Corti, L. & Berlanda, N. Beyond infertility: obstetrical and postpartum complications associated with endometriosis and adenomyosis. Fertil. Steril. 104 , 802–812 (2015).

Donnez, J. & Squifflet, J. Complications, pregnancy and recurrence in a prospective series of 500 patients operated on by the shaving technique for deep rectovaginal endometriotic nodules. Hum. Reprod. 25 , 1949–1958 (2010).

Zanelotti, A. & Decherney, A. H. Surgery and endometriosis. Clin. Obstet. Gynecol. 60 , 477–484 (2017).

Olive, D. L. Medical therapy of endometriosis. Semin. Reprod. Med. 21 , 209–222 (2003).

Harada, T., Momoeda, M., Taketani, Y., Hoshiai, H. & Terakawa, N. Low-dose oral contraceptive pill for dysmenorrhea associated with endometriosis: a placebo-controlled, double-blind, randomized trial. Fertil. Steril. 90 , 1583–1588 (2008).

Vercellini, P. et al. Treatment of symptomatic rectovaginal endometriosis with an estrogen–progestogen combination versus low-dose norethindrone acetate. Fertil. Steril. 84 , 1375–1387 (2005).

Harada, T. et al. Dienogest is as effective as intranasal buserelin acetate for the relief of pain symptoms associated with endometriosis — a randomized, double-blind, multicenter, controlled trial. Fertil. Steril. 91 , 675–681 (2009).

Casper, R. F. Progestin-only pills may be a better first-line treatment for endometriosis than combined estrogen-progestin contraceptive pills. Fertil. Steril. 107 , 533–536 (2017).

Abou-Setta, A. M., Houston, B., Al-Inany, H. G. & Farquhar, C. Levonorgestrel-releasing intrauterine device (LNG-IUD) for symptomatic endometriosis following surgery. Cochrane Database Syst. Rev. 1 , CD005072 (2013).

Brown, J., Pan, A. & Hart, R. J. Gonadotrophin-releasing hormone analogues for pain associated with endometriosis. Cochrane Database Syst. Rev. 12 , CD008475 (2010).

Sagsveen, M. et al. Gonadotrophin-releasing hormone analogues for endometriosis: bone mineral density. Cochrane Database Syst. Rev. 4 , CD001297 (2003).

Bedaiwy, M. A., Allaire, C. & Alfaraj, S. Long-term medical management of endometriosis with dienogest and with a gonadotropin-releasing hormone agonist and add-back hormone therapy. Fertil. Steril. 107 , 537–548 (2017).

Taylor, H. S. et al. Treatment of endometriosis-associated pain with elagolix, an oral GnRH antagonist. N. Engl. J. Med. 377 , 28–40 (2017).

Hornstein, M. D. An oral GnRH antagonist for endometriosis — a new drug for an old disease. N. Engl. J. Med. 377 , 81–83 (2017).

Bedaiwy, M. A., Alfaraj, S., Yong, P. & Casper, R. New developments in the medical treatment of endometriosis. Fertil. Steril. 107 , 555–565 (2017).

Shakiba, K., Bena, J. F., McGill, K. M., Minger, J. & Falcone, T. Surgical treatment of endometriosis. Obstet. Gynecol. 111 , 1285–1292 (2008).

Vercellini, P. Laparoscopic uterosacral ligament resection for dysmenorrhea associated with endometriosis: results of a randomized, controlled trial. Fertil. Steril. 68 , S3 (1997).

Meuleman, C. et al. Surgical treatment of deeply infiltrating endometriosis with colorectal involvement. Hum. Reprod. Update 17 , 311–326 (2011).

Koga, K., Takamura, M., Fujii, T. & Osuga, Y. Prevention of the recurrence of symptom and lesions after conservative surgery for endometriosis. Fertil. Steril. 104 , 793–801 (2015).

Gao, X. et al. Health-related quality of life burden of women with endometriosis: a literature review. Curr. Med. Res. Opin. 22 , 1787–1797 (2006).

Simoens, S. et al. The burden of endometriosis: costs and quality of life of women with endometriosis and treated in referral centres. Hum. Reprod. 27 , 1292–1299 (2012). This prospective study calculates the average annual costs and HRQOL per woman with endometriosis-associated symptoms, showing it to be similar to other chronic conditions .

Jones, G., Kennedy, S., Barnard, A., Wong, J. & Jenkinson, C. Development of an endometriosis quality-of-life instrument. Obstet. Gynecol. 98 , 258–264 (2001). This study describes the only validated endometriosis-specific quality-of-life outcome tool developed, measuring endometriosis-related health status on five scales. The tool has since been shown to be sensitive to changes in symptoms, making it a useful tool in endometriosis-specific clinical trials .

Jones, G., Jenkinson, C. & Kennedy, S. Development of the short form endometriosis health profile questionnaire: the EHP-5. Qual. Life Res. 13 , 695–704 (2004).

Jones, G., Jenkinson, C. & Kennedy, S. Evaluating the responsiveness of the endometriosis health profile questionnaire: the EHP-30. Qual. Life Res. 13 , 705–713 (2004).

Hirsch, M. et al. Variation in outcome reporting in endometriosis trials: a systematic review. Am. J. Obstet. Gynecol. 214 , 452–464 (2016).

Khan, K. The CROWN Initiative: journal editors invite researchers to develop core outcomes in women’s health. BJOG 123 , 103–104 (2016).

van Nooten, F. E., Cline, J., Elash, C. A., Paty, J. & Reaney, M. Development and content validation of a patient-reported endometriosis pain daily diary. Health Qual. Life Outcomes 16 , 3 (2018).

Rogers, P. A. W. et al. Research priorities for endometriosis. Reprod. Sci. 24 , 202–226 (2017).

Butrick, C. W. Patients with chronic pelvic pain: endometriosis or interstitial cystitis/painful bladder syndrome? JSLS 11 , 182–189 (2007).

Sørlie, T. et al. Repeated observation of breast tumor subtypes in independent gene expression data sets. Proc. Natl Acad. Sci. USA 100 , 8418–8423 (2003).

Cancer Genome Atlas Network. et al. Comprehensive molecular portraits of human breast tumours. Nature 490 , 61–70 (2012).

Gupta, D. et al. Endometrial biomarkers for the non-invasive diagnosis of endometriosis. Cochrane Database Syst. Rev. 4 , CD012165 (2016).

Nisenblat, V. et al. Combination of the non-invasive tests for the diagnosis of endometriosis. Cochrane Database Syst. Rev. 7 , CD012281 (2016).

Nisenblat, V., Bossuyt, P. M. M., Farquhar, C., Johnson, N. & Hull, M. L. Imaging modalities for the non-invasive diagnosis of endometriosis. Cochrane Database Syst. Rev. 2 , CD009591 (2016).

May, K. E. et al. Peripheral biomarkers of endometriosis: a systematic review. Hum. Reprod. Update 16 , 651–674 (2010).

May, K. E., Villar, J., Kirtley, S., Kennedy, S. H. & Becker, C. M. Endometrial alterations in endometriosis: a systematic review of putative biomarkers. Hum. Reprod. Update 17 , 637–653 (2011).

van der Zanden, M. & Nap, A. W. Knowledge of, and treatment strategies for, endometriosis among general practitioners. Reprod. Biomed. Online 32 , 527–531 (2016).

Seear, K. The etiquette of endometriosis: stigmatisation, menstrual concealment and the diagnostic delay. Soc. Sci. Med. 69 , 1220–1227 (2009).

Greene, R., Stratton, P., Cleary, S. D., Ballweg, M. L. & Sinaii, N. Diagnostic experience among 4,334 women reporting surgically diagnosed endometriosis. Fertil. Steril. 91 , 32–39 (2009).

Horne, A. W., Saunders, P. T. K., Abokhrais, I. M. & Hogg, L. Top ten endometriosis research priorities in the UK and Ireland. Lancet 389 , 2191–2192 (2017).

Hans Evers, J. L. H. Is adolescent endometriosis a progressive disease that needs to be diagnosed and treated? Hum. Reprod. 28 , 2023 (2013).

Neal, D. M. & McKenzie, P. J. Putting the pieces together: endometriosis blogs, cognitive authority, and collaborative information behavior. J. Med. Libr. Assoc. 99 , 127–134 (2011).

Uno, S. et al. A genome-wide association study identifies genetic variants in the CDKN2BAS locus associated with endometriosis in Japanese. Nat. Genet. 42 , 707–710 (2010).

Painter, J. N. et al. Genome-wide association study identifies a locus at 7p15.2 associated with endometriosis. Nat. Genet. 43 , 51–54 (2011).

Albertsen, H. M., Chettier, R., Farrington, P. & Ward, K. Genome-wide association study link novel loci to endometriosis. PLoS ONE 8 , e58257 (2013).

Steinthorsdottir, V. et al. Common variants upstream of KDR encoding VEGFR2 and in TTC39B associate with endometriosis. Nat. Commun. 7 , 12350 (2016).

Sobalska-Kwapis, M. et al. New variants near RHOJ and C2, HLA-DRA region and susceptibility to endometriosis in the Polish population — the genome-wide association study. Eur. J. Obstet. Gynecol. Reprod. Biol. 217 , 106–112 (2017).

Download references

Acknowledgements

R.N.T. acknowledges funding from the Eunice Kennedy Shriver National Institute of Child Health and Human Development through grants R01-HD33238, U54-HD37321, U54-HD55787, R01-HD55379, U01-HD66439 and R21-HD78818. S.A.M. is also affiliated with the Boston Center for Endometriosis, Boston Children’s Hospital and Brigham and Women’s Hospital and the Division of Adolescent and Young Adult Medicine, Department of Medicine, Boston Children’s Hospital and Harvard Medical School. The authors thank N. Moore (Oxford University Hospitals Foundation Trust, UK) for providing MRI images, D. Barber (Oxford Endometriosis CaRe Centre, UK) for providing ultrasonography pictures and J. Malzahn (Nuffield Department of Orthopaedics, Rheumatology and Musculoskeletal Sciences, University of Oxford, UK) for providing the picture of the histology slide in Fig. 5.

Reviewer information

Nature Reviews Disease Primers thanks I. Brosens, M. J. Canis, S. Ferrero, C. Nezhat, V. Remorgida, M. Simões Abrão and other anonymous referee(s) for the peer review of this work.

Author information

Authors and affiliations.

Oxford Endometriosis CaRe Centre, Nuffield Department of Women’s & Reproductive Health, University of Oxford, Oxford, UK

Krina T. Zondervan & Christian M. Becker

Wellcome Centre for Human Genetics, University of Oxford, Oxford, UK

Krina T. Zondervan

Department of Obstetrics and Gynecology, The University of Tokyo, Tokyo, Japan

Department of Epidemiology, Harvard T.H. Chan School of Public Health, Boston, MA, USA

Stacey A. Missmer

Department of Obstetrics, Gynecology and Reproductive Biology, College of Human Medicine, Michigan State University, Grand Rapids, MI, USA

Department of Obstetrics and Gynecology, University of Utah School of Medicine, Salt Lake City, UT, USA

Robert N. Taylor

Division of Genetics and Cell Biology, San Raffaele Scientific Institute, Milano, Italy

Paola Viganò

You can also search for this author in PubMed   Google Scholar

Contributions

Introduction (K.T.Z.); Epidemiology (S.A.M.); Mechanisms/pathophysiology (R.N.T. and P.V.); Diagnosis, screening and prevention (C.M.B.); Management (K.K.); Quality of life (K.T.Z.); Outlook (K.T.Z.); Overview of the Primer (K.T.Z.).

Corresponding author

Correspondence to Krina T. Zondervan .

Ethics declarations

Competing interests.

K.T.Z. has received grant funding from the Wellcome Trust, Medical Research Council UK, the US NIH, the European Union and the World Endometriosis Research Foundation (WERF). She also has scientific collaborations with, and has received grant funding from, Bayer AG, MDNA Life Sciences, Roche Diagnostics and Volition Rx and has served as a scientific consultant to AbbVie and Roche Diagnostics. She is Secretary of the World Endometriosis Society (WES), the European Society of Human Reproduction and Embryology (ESHRE) Special Interest Group in Endometriosis and Endometrial Disorders and Wellbeing of Women, and she is Chair of the WES Research Directions Working Group. C.M.B. is a member of the independent data monitoring group for a clinical endometriosis trial by ObsEva. He has received research grants from Bayer AG, MDNA Life Sciences, Volition Rx and Roche Diagnostics as well as from Wellbeing of Women, Medical Research Council UK, the NIH, the UK National Institute for Health Research and the European Union. He is the current Chair of the Endometriosis Guideline Development Group of the ESHRE and was a co-opted member of the Endometriosis Guideline Group by the UK National Institute for Health and Care Excellence (NICE). K.K. has received grant funding from the Ministry of Education, Culture, Sports Science and Technology Japan, the Ministry of Health, Labour and Welfare Japan, Takeda Research Support and MSD. She has also served as a scientific consultant to Bayer AG. She is an ambassador of the WES and a member of the Guideline Development Group of the Japan Society of Obstetrics and Gynecology. S.A.M. has received grant funding from the NIH and the Marriott family foundations and has served as an adviser to and has scientific collaborations with AbbVie, Celmatix and Oratel Diagnostics. She is a treasurer of the WES, Secretary of the WERF, Chair of the American Society of Reproductive Medicine Endometriosis Special Interest Group and a member of the NIH Reproductive Medicine Network Data Safety and Monitoring Board. R.N.T. has received grant funding from Bayer AG, Ferring Research Institute, the NIH and Pfizer and has served as a scientific consultant or adviser to AbbVie, Allergan, the NIH, ObsEva SA and the Population Council. He is the immediate past honorary secretary of the WES. P.V. has received grant funding from Bayer AG and Merck Serono and has served as a scientific consultant to Ferring Pharmaceuticals and Roche Diagnostics. She is a board member of the WES.

Additional information

Publisher’s note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Related links

WERF Endometriosis Phenome and Biobanking Harmonisation Project: https://endometriosisfoundation.org/ephect/

Rights and permissions

Reprints and permissions

About this article

Cite this article.

Zondervan, K.T., Becker, C.M., Koga, K. et al. Endometriosis. Nat Rev Dis Primers 4 , 9 (2018). https://doi.org/10.1038/s41572-018-0008-5

Download citation

Published : 19 July 2018

DOI : https://doi.org/10.1038/s41572-018-0008-5

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

This article is cited by

Efficacy and safety of eliapixant in endometriosis-associated pelvic pain: the randomized, placebo-controlled phase 2b schumann study.

• Susanne Parke
• Kerstin Gude
• Fabrizio Messina

BMC Women's Health (2024)

Vitamin D and reproductive disorders: a comprehensive review with a focus on endometriosis

• Pooya Farhangnia
• Morvarid Noormohammadi
• Ali-Akbar Delbandi

Reproductive Health (2024)

Impact of oil-based contrast agents in hysterosalpingography on fertility outcomes in endometriosis: a retrospective cohort study

• Yingqin Huang

Reproductive Biology and Endocrinology (2024)

Unraveling pathogenesis, biomarkers and potential therapeutic agents for endometriosis associated with disulfidptosis based on bioinformatics analysis, machine learning and experiment validation

• Xiaoxuan Zhao

Journal of Biological Engineering (2024)

Efficacy and safety of a novel pain management device, AT-04, for endometriosis-related pain: study protocol for a phase III randomized controlled trial

• Hiroshi Ishikawa
• Osamu Yoshino

Quick links

• Explore articles by subject
• Guide to authors
• Editorial policies

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

• Open access
• Published: 29 November 2021

Treatment of endometriosis: a review with comparison of 8 guidelines

• Dimitrios Rafail Kalaitzopoulos   ORCID: orcid.org/0000-0002-8053-1308 1 , 3 ,
• Nicolas Samartzis 1 ,
• Georgios N. Kolovos 1 ,
• Evangelia Mareti 2 ,
• Eleftherios Pierre Samartzis 3 ,
• Markus Eberhard 1 ,
• Kostantinos Dinas 2 &
• Angelos Daniilidis 2  

BMC Women's Health volume  21 , Article number:  397 ( 2021 ) Cite this article

38k Accesses

71 Citations

36 Altmetric

Metrics details

Endometriosis, the presence of endometrial-like tissue outside the uterus, is a common clinical entity between women of reproductive age, with a prevalence of about 10%. Due to the variety of endometriosis-associated symptoms, a great variety of treatments have been implemented. The aim of this review is to give an overview on therapeutical approaches of eight national and international widely used guidelines.

Six national (College National des Gynecologues et Obstetriciens Francais, National German Guideline (S2k), Society of Obstetricians and Gynaecologists of Canada, American College of Obstetricians (ACOG) and Gynecologists, American Society for Reproductive Medicine (ASRM) and National Institute for Health and Care (NICE) and two international (World Endometriosis Society, European Society of Human Reproduction and Embryology) guidelines are included in this review.

All the above-mentioned guidelines agree that the combined oral contraceptive pill, progestogens are therapies recommended for endometriosis associated pain. Concerning infertility, there is no clear consensus about surgical treatment. Discrepancies are also found on recommendation of the second- and third-line treatments.

Peer Review reports

Introduction

Endometriosis is an inflammatory entity with the presence of endometrial-like tissue outside the uterine cavity. It mainly affects women of reproductive age, with a prevalence of about 10% [ 1 ]. The wide range of symptoms, such as chronic pelvic pain, dysmenorrhea, infertility, dyspareunia, dysuria, dyschezia and fatigue which characterize this estrogen-dependent condition, result to a delayed diagnosis. The importance of endometriosis as a major health issue with socioeconomical impact is underlined by the EndoCost study, which showed that costs arising from endometriosis are comparable to that of other chronic diseases, such as diabetes mellitus [ 2 ]. Many gynecological societies have published different guidelines in order to help the clinicians with the diagnosis and treatment of endometriosis. The variety of the available treatments in combination with complexity of this illness leads to significant discrepancies between the recommendations. As previous showed, there is only a 7% agreement between the widely used guidelines and none of them is following the Appraisal of Guidelines for Research and Evaluation II (AGREE-II) protocol [ 3 ]. The aim of this review is to give an overview about treatment of endometriosis after comparing eight widely used endometriosis guidelines.

Material and methods

This review includes six national and two international guidelines of endometriosis. Two independent reviewers (DRK, NS) selected all the included guidelines available by September 2020 and extracted all the recommendation in standardized excel sheets according the type of recommendation and its evidence grade (Tables 1 , 2 ).

National guidelines: College National des Gynecologues et Obstetriciens Francais 2018 (CNGOF) [ 4 ], National German Guideline (S2k) 2014 [ 5 ], Society of Obstetricians and Gynaecologists of Canada (SOGC) 2010 [ 6 ], American College of Obstetricians and Gynecologists (ACOG) 2010 [ 7 ], American Society for Reproductive Medicine (ASRM) 2012 for infertility and 2014 for endometriosis associated pain [ 8 , 9 ] and National Institute for Health and Care (NICE) 2018 [ 10 ].

International guidelines: World Endometriosis Society (WES) 2011 [ 11 ] and European Society of Human Reproduction and Embryology (ESHRE) 2013 [ 12 ].

Surgical treatment of endometriosis

Surgical approach.

All the included guidelines recommend laparoscopic surgery in preference to laparotomy for chronic pain of endometriosis and infertility, because of less pain, shorter duration of hospitalisation, quicker recovery and better cosmetic result [ 13 ]. ESHRE guidelines reports that laparotomy and laparoscopy are equally effective in the treatment of endometriosis-associated pain. None of the above guidelines mentions robotic surgery as an option for endometriosis surgery. A meta-analysis of the available studies showed no other difference in perioperative outcomes between robotic and conventional laparoscopic surgery, except the longer time that is needed in robotic surgery [ 14 ]. ASRM suggests that multiple surgical procedures should be avoided because of adhesions and reduction of ovarian reserves. According to ESHRE, CNGOF guidelines no preoperative hormonal treatment is recommended, while the above guidelines and additional the NICE and SOGC guidelines recommend that postoperative hormonal treatment could be considered a secondary prevention. ASRM, ACOG, S2k and WES report conflicting evidence about postoperative treatment in women with endometriosis associated pain or endometrioma.

Vaginal procedures for treatment of deep infiltrating endometriosis are discussed in CNGOF 2007, S2k and ESHRE guidelines. CNGOF 2007 underlines that skilled surgeons should carry out laparoscopically assisted vaginal procedures and according to experience of the guideline development group exclusively vaginal operations are not recommended, while the latest version of CNGOF guideline does not take position on this issue. The available literature about laparoscopically assisted vaginal procedures includes a few retrospective studies with small number of patients, which conclude that this technic could be considered only for the treatment of rectovaginal endometriosis ( 15 ).

Peritoneal endometriosis

CNGOF, ESHRE, S2k, ASRM and SOGC recommend the treatment of superficial endometriosis in patients with endometriosis associated pain. CNGOF, ESHRE and ASRM do not give a preference about the different techniques (ablation, excision), while both S2k and SOGC explicitly mention the lack of evidence. WES recommends in general excision of any kind of endometriosis lesions. The recent evidence is though unclear about the benefit of peritoneal endometriosis excision in women with chronic pain [ 16 , 17 ].

CNGOF, NICE, WES, ESHREM S2k ACOG and ASRM recommendations agree that women with suspected mild endometriosis and infertility should be considered candidates for surgical treatment. A Cochrane meta-analyses showed an increased birth rate odds ratio of 1.94, 95% CI 1.20–3.16 for patients with infertility who underwent surgery for excision of the endometrial implants [ 18 ].

Ovarian endometriosis

For surgical treatment all of the included guidelines follow the recommendation of Hart et al. [ 19 ]. In this Cochrane review the authors concluded that laparoscopically cystectomy of endometriomas measuring more than 3 cm was superior to drainage and ablation with electrocoagulation in terms of lower recurrence of dysmenorrhoea, dyspareunia, cyst recurrences and the need for further surgical interventions. Only ESHRE and CNGOF discuss laser vaporization in treatment of endometriomas. After “one-step” laser vaporization, a greater recurrence of endometriosis related ovarian cysts was observed after 12 months of follow up according to Carmona et al. [ 20 ]. Nevertheless, recurrence rate did not differ statistically significant after 5 years compared to cystectomy. According to ASRM, simple drainage has a little therapeutic value as recurrence rate is 80–100% and therefore is no longer being performed. ACOG points out, that, cyst wall should be removed to obtain a histological sample, especially in women without a previous diagnosis of endometriosis, in order to exclude the small risk of malignancy [ 21 ].

CNGOF and ASRM underline that surgical treatment of endometriomas by cystectomy or ablation can reduce ovarian reserve, with negative implication on fertility. The risk increases for woman with large, recurrent or bilateral endometriomas. Measurement of AMH prior to ovarian surgery has to be considered.

In infertile patients surgery of endometriomas does not improve the outcome of IVF according to the same guideline. ESHRE recommends that cystectomy possible should be performed, rather than ablation or other therapeutic managements in infertile patients, while according to S2k, the effect of ovarian endometriomas on the outcome of IVF is unclear. WES reminds that oocyte freezing should be discussed in young women prior to surgery of endometrioma [ 22 ]. Conclusively independent of the surgical method of intervention, the concept of minimizing the negative effects on the ovarian reserve should consist a priority [ 23 ].

Deep infiltrating endometriosis (DIE)

All guidelines except of NICE and ASRM, recommend excision of deep infiltrating endometriosis nodules for endometriosis associated pain. The management about fertility is controversial. This procedure because of the complexity should be performed by experts. ESHRE mentions that surgery in women with deep endometriosis is associated with substantial intraoperative and postoperative complication rates and according to CNGOF possible complications are leaks from anastomosis, fistulas, rectal dysfunction and bladder atony caused by surgical alteration of the hypogastric plexus (splanchnic nerves) which are unavoidable in some cases. ESHRE underlines the controversial results between shaving and segmental resection. Bladder endometriosis excision is recommended by ESHRE and CNGOF. Last but not least, NICE and the German group recommend a preoperative imaging with ultrasound or MRI. ESGE/ESHRE/WES published on February 2020 recommendations on the technical aspect of different surgical approaches for deep infiltrating endometriosis [ 24 ].

Hysterectomy

All of the above-mentioned societies concur that hysterectomy with the simultaneous excision of endometriotic lesions is considered to be the last solution in women who have fulfilled their family planning and fail to respond to more conservative treatments. When hysterectomy is going to be performed, according to WES and NICE guidelines, it should be done laparoscopically. As far as ovarian preservation is concerned some discrepancies between the recommendations of the above guidelines exist. According to CNGOF, NICE, ESHRE and ASRM hysterectomy with bilateral salpingo-oophorectomy (TAHBSO) should be the preferred in the prospect of lowering the risk pain recurrence and reoperation, while JOGC and ACOG refer that ovarian preservation should be considered in patients with normal ovaries. If HRT needed for the treatment of menopausal symptoms, the German society (S2k) and ASRM recommend the use of combined estrogen-progestogen therapy. The risk of endometriosis recurrence after hysterectomy constantly exists and diverse theories have been proposed, such as residual microscopic foci, hormonal factors, ovarian remnants, uterine morcellation, lymphovascular invasion, and de-novo disease [ 25 ].

According to Vercellini et al., patients should always be informed that there is an approximate 15% probability of pain persistence after standard hysterectomy with a 3–5% risk of worsening of pain or development of new symptoms [ 26 ].

A tailored radical hysterectomy for patients with deep infiltrating endometriosis including removal of the uterus, adnexa, posterior and anterior parametria, endometriotic lesions and upper one-third of the vagina with lesions of lateral and posterior vaginal epithelium is proposed by Fedele et al. [ 27 ].

Adhesiolysis

Adhesions have a negative influence on fertility by altering the adnexal anatomy, gamete and embryo transport [ 28 ]. Although there is insufficient data about the effect of isolated adhesiolysis on endometriosis associated pain, only two societies ESHRE reports adhesiolysis as a method for treating endometriosis-associated pain and recommend that clinicians should be aware of use of anti-adhesion agents in order to prevent and minimize adhesion formation. With regards to fertility, ESHRE and NICE recommend that adhesiolysis improves the chance of spontaneous pregnancy, while according to JOGC anti-adhesion agents may reduce the formation of adhesions but the outcome in fertility is not proven.

Conclusively, a Cochrane review reports no evidence of available agents, oxidised regenerated cellulose (Interceed ®), expanded polytetrafluoroethylene (Gore-Tex ®) and sodium hyaluronate with carboxymethylcellulose (Seprafilm ®) on pelvic pain and fertility [ 29 ].

Laparoscopic uterine nerve ablation (LUNA) and presacral neurectomy (PSN)

Many societies including the WES, S2k, ASRM and ESHRE have examined the possible role of laparoscopic uterine nerve ablation for the management of endometriosis associated pain. Laparoscopic uterine nerve ablation (LUNA) is a technique designed to disrupt the efferent nerve fibres in the uterosacral ligaments with the purpose of decreasing uterine pain in women with intractable dysmenorrhea. Ultimately, a common conclusion is reached according to Cochrane Review of Proctor et al., which showed that LUNA has no beneficial effect on dysmenorrhea and endometriosis-associated chronic pain [ 30 ].

On the other hand, presacral neurectomy has been suggested as an effective additional method for treatment of midline pain in patient with endometriosis [ 31 ]. Although it is important to recognize that presacral neurectomy is a technically challenging procedure associated with significant risk of bleeding from the adjacent venous plexus. Possible side effects of presacral neurectomy such as haematoma, constipation and urinary dysfunction are mentioned by the ACOG guidelines. Consequently, ESHRE guideline emphasizes that presacral neurectomy requires a high degree of skill from an experienced surgical team.

Medical treatment of endometriosis

Progestines.

All eight guidelines recommend progestins as first-line medical treatment for pain in endometriosis. In this paragraph we try to investigate the different types and ways of administration of progestins on the treatment of endometriosis.

Dienogest (DNG) is 19-nortestosterone derivative, a fourth generation orally active progestogen with a high specificity for the progesterone receptor (PR) [ 32 ]. The most common used dosage, 2 mg per day, causes only a minimal reduction of the estrogen levels, thus, none hypoestrogenic side effect is described [ 33 ]. WES and S2k recommend dienogest prior to other progestines. S2k and CNGOF underline, that in two RCTs the administration of dienogest showed comparable efficacy to GnRH-analogues with better tolerability [ 34 , 35 ].

Medroxyprogesterone acetate

Medroxyprogesterone acetate, a 17OH-progesterone derivative, is commonly used as a three monthly intramuscularly or subcutaneously administered contraceptive method (58). It belongs to first line therapies for endometriosis-associated pain according to the two American societies, the Canadian society and ESHRE. The evidence grade varies between the above societies. WES underlines the weak evidence grade and classifies the above therapy as a second line treatment.

Medroxyprogesterone acetate seems to be an effective and very economical therapy in relieving endometriosis-associated pain, with substantially less bone loss than GnRH agonists [ 36 ].

Levonorgestrel-IUS

LNG-IUS is a commonly used mechanic and hormonal contraceptive method, releasing a 19-nortesterone derivative directly into the uterine cavity over a period of 5 years. The proposed mechanisms of levonorgestrel-IUS on endometriosis therapy are the induction of endometrial glandular atrophy, transformation of the stroma, the downregulation of endometrial cell proliferation and the intensification in apoptotic activities [ 37 ].

ACOG mentions, that levonorgestrel intrauterine system is similar effective as GnRH agonist in reducing endometriosis-associated pelvic. ASRM and CNGOF in concordance to a recent meta-analysis point out, that levonorgestrel intrauterine system reduces the recurrence of dysmenorrhoea after surgical treatment of endometriosis [ 38 ].

Combined Oral Contraceptives Pills

The combined oral contraceptive pill (COC) is a widespread contraceptive method which is also used widely from clinicians empirically in patients with dysmenorrhea. Most of the included guidelines propose combined oral contraceptives as a first empirical medical treatment in endometriosis associated pain before performing diagnostic laparoscopy although the reported level of evidence differs. A meta-analysis from Brown et al. showed that use of COCs in comparison with placebo is associated with relief of dysmenorrhoea, however in comparison with GnRH analogue there were no superiority of treatment. The authors of this meta-analysis underline that the above conclusions should not be generalised, because of the limited available evidence [ 39 ].

Only CNGOF and WES refer the possibility of using COCs for downregulation before ART in patients with endometriosis. A Cochrane review underlines the limitation of the available data on the role of COC before IVF [ 40 ].

Nonsteroidal anti-inflammatory drugs (NSAIDs) are widely used for symptomatic treatment of dysmenorrhoea and acyclic pelvic pain. In most of the guidelines of these eight societies the use of NSAIDs is described. NSAIDs are considered to be a symptomatic first line treatment, a long-term use is not recommended because of the possible side effects. The last Cochrane review, showed lack of high quality evidence and no difference in pain relief in comparison with placebo [ 41 ].

Gonadotropin Releasing Hormones (GnRH) agonists

GnRH agonists use in endometriosis patients is reserved for patients with persistent symptoms after the use of first line therapy. All the above societies agree that GnRH agonists can reduce the endometriosis associated pain. CNGOF recommends that GnRH agonists with add-back therapy should not be used for more than one year, SOGC recommends a duration not longer than 6 months, while ESHRE underlines that there is not sufficient evidence about the duration of the above therapy. German society (S2k) recommends that GnRH agonists are not appropriate treatment for ovarian endometriomas[ 42 ]. In infertile patients is concerned, WES, CNGOF and SOGC propose downregulation with GnRH agonist 3–6 months prior to IVF in order to improve pregnancy rate. ACOG and German society contradict to this recommendation because clinical pregnancy rate and live birth rate data is not conclusive [ 43 ].

The clinicians have to take into consideration the hypoestrogenic side effects for example vasomotor symptoms and accelerated bone loss. According to FDA the use of the above medicaments should be restricted to six months. Progestin-only and progestin with low dose oestrogen (0.625 mg) add-back therapy are both associated with reduction of the side effects [ 44 ].

Gonadotropin Releasing Hormones (GnRH) antagonists

GnRH antagonist is new promising medical treatments for women with endometriosis associated pain, inducing a dose-dependent ovarian suppression. Two RCTs compared elagolix® with placebo and showed a reduction of dysmenorrhoea and nonmestrual pelvic pain, although the comparison between elagolix® and medroxyprogesterone acetate did not show significant difference in pain reduction. Studies comparing the above medication with other possible treatment and long term outcomes are not published yet [ 45 ]. Only four guidelines (ESHRE, ASRM, CNGOF and WES) refer GnRH antagonist as a possible therapeutic option for endometriosis related pain although all of the above underline that the evidence is not enough.

Aromatase inhibitors

Aromatase inhibitors block the enzymatic activity of aromatase reducing the synthesis of estrogen in the ovaries and peripheral tissues [ 46 ].

NICE and German society (S2k) guidelines do not refer aromatase inhibitors as a possible endometriosis treatment. All the other societies agree that it could be a second line therapy for endometriosis-associated pain reduction, although the evidence is not enough. ASRM guidelines statement is that the above therapy should not be considered as a definitive therapy, as it is not FDA approved for endometriosis. ESHRE underlines that aromatase inhibitors could be used in combination with oral contraceptive pills, progestagens, or GnRH analogues in order to avoid the ovarian stimulation.

Aromatase inhibitors reduce endometriosis-associated pain, intestinal symptoms, urinary symptoms and decrease the volume of laparoscopically visible endometriosis, rectovaginal infiltrating endometriosis and endometriomas. The above treatment improve the quality of life when used with gestagens, oral contraceptives or GnRH-agonists. Ferrero et al. conclude that aromatase inhibitors should be offered to women with pain persistence after previous surgical and hormonal treatment [ 47 ].

Endometriosis can affect about 2–5% of postmenopausal patients. In this group, aromatase inhibitors seem to be a possible medical treatment as the largest amount of estrogens is produced from extra-ovarian sources [ 48 ]. Long-term use is associated with hypoestrogenic side effects, such as vaginal dryness, hot flushes, headache, arthralgia and with an increased risk for bone fractures, osteoporosis and osteopenia [ 46 ].

Danazol is an androgenic drug, that was used for the treatment of endometriosis related pain for more than 40 years. Because of the hyperandrogenic side effects (weight gain, acne, hirsutisms, breast atrophy and virilisation), low dose vaginal administration has been proposed [ 49 ].

As far as the use of danazol in treatment of endometriosis pain is concerned, ACOG is the only guideline which still propose the above medication as a possible first line therapy. WES, ESHRE and SOGC are critical because of the side effects and WES recommends to use it only in women who have already had a well-tolerated treatment with danazol before. S2k and ASRM do not have an official recommendation.

According to ESHRE and NICE guidelines, danazol for infertile patients should not be recommended while according to WES there is not enough evidence.

Gestrinone, one of the first drugs for the treatment of endometriosis and myomas, which acts centrally on the hypothalamic pituitary system by supressing the release of lutenizing hormone (LH) and follicle-stimulating hormone (FSH) is actually not widely used [ 50 ]. Only WES and ESHRE discuss the use of gestrinone as a possible medication for the treatment of endometriosis related pain, while ASRM underlines that this therapy is at the moment not available in the United States. WES is the only society which refers that there is limited evidence about the role of gestrinone in the therapy of women with infertility.

Selective estrogen receptor modulators (SERM)

SERMs have tissue-specific estrogen receptor agonist and antagonist effects. ESHRE, CNGOF and ASRM refer that there is not enough evidence for treatment of endometriosis associated pain. NICE guideline does not recommend SERM as endometriosis related infertility treatment.

Selective progesterone receptor modulators (SPRM)

Selective progesterone receptor modulators have a variable effect on progesterone receptors which varies from pure agonistic to pure antagonistic. A systematic review showed that mifepristone, is more effective than placebo for dysmenorrhoea and dyspareunia, although the current literature does not provide enough evidence for long-term safety and efficacy of this treatment [ 51 ].

WES recommends that SPRM could be a second line therapy, while ESHRE, CNGOF and ASRM underlines that evidence is not sufficient. NICE guideline does not recommend SPRM as a treatment for endometriosis-associated infertility.

Nonhormone treatments

A possible option for endometriosis-associated pain is pentoxifylline, a nonselective phosphodiesterase inhibitor with immunomodulatory properties, which, according to WES, ESHRE and ASRM, could not be recommended as a standard therapy for endometriosis due to the lack of evidence to date [ 52 ].

In the same way, antiangiogenic agents, such as anti-TNF-a and infliximab have been evaluated as a potential endometriosis treatment. WES, CNGOF and ASRM agree that there is no benefit according to available studies [ 53 ].

Complementary therapies

Acupuncture.

Acupuncture nowadays serves as complementary method for the treatment of endometriosis related pain when conservative and surgical methods fail to relieve the patient’s symptoms, reducing the pain through the mechanism of stimulation by diffusion of noxious inhibitory controls. A meta-analysis including two RCTs comparing acupuncture with placebo showed a significant reduction of pelvic pain (RR –1.93, 95% CI –3.33, –0.53, p  = 0.007) [ 54 ]. According to CNGOF and ASRM acupuncture can improve the quality of life in patient with endometriosis-related pain. SOGC recommends that acupuncture should be conducted by specialists. On the other side WES, S2k, ESHRE and NICE does not recommend acupuncture as therapy for endometriosis associated symptoms.

Electrotherapy

Transcutaneous Electrical Nerve Stimulation (TENS) is the most commonly used electrical stimulation for pain therapy by directly blocking transmission of pain signals along nerves. After comparing acupuncture with TENS applied in the sacral region by endometriosis patients, both methods showed reduction of chronic pelvic pain ( p  < 0.001), deep dyspareunia ( p  = 0.001) and improvement of the quality of life ( p  < 0.001) of women with deep endometriosis [ 54 ]. CNGOF reports, that TENS has been found to be of value in primary dysmenorrhoea. WES and S2k agree that the evidence is not sufficient, while ESHRE recommends the above methods to be used only by experts and SOGC does not recommend this complementary treatment.

Dietary products and vitamins

Limited evidence exists in the bibliography on the effectiveness of the dietary methods to face the endometriosis related pain. Crucial part of this category is the dietary supplements and vitamins, especially B1, B6 and D [ 55 , 56 , 57 ]. Although a lot of medications and interventional methods have been studied, there is a lack of a randomized controlled trial to examine the efficacy of the behavioural and lifestyle habits. As a conclusion, these methods have not yet been established and are not even mentioned by most of the guidelines as an effective method to reduce the pain induced by endometriosis lesions.

Conclusively, this is a review and summary of the eight most widely accepted guidelines concerning the management of endometriosis. Pain and infertility are the major components of endometriosis that most usually lead patients in seeking an expert opinion.

Regarding pharmacological therapies of endometriosis associated pain, the most of the included guidelines suggest progestins, either in the form of dienogest or of medroxyprogestetrone acetate, and combined oral contraceptives as first line therapy with a great evidence grade. GNRH-agonists and levonorgestrel intrauterine system could be considered as second line treatment. About the remaining medical options such as danazol, gestrinone, aromatase inhibitors, SERMs and SPRMs because of the limited evidence there are discrepancies between the guidelines. Important is also the role of surgery on treatment endometriosis related pain, where the standard of practice is the excision of the endometrial implants as well as the excision of the endometriomas. In general, it is advised to handle the ovarian tissue as atraumatic as possible, to reduce the decrease of ovarian reserve. At last, complementary options such as dietary products, acupuncture and electrotherapy are not yet studied enough in order to have a better perspective of their role.

When it comes to infertility the available therapeutic options and the therapeutic strategies differ in comparison to the endometriosis associated pain. The surgical procedures such as excision of endometriomas and endometriosis excision have gained the greatest evidence grade and consist the standard approach. Ablation of the ovarian endometriosis is a second line therapy, while pharmacological therapies are in principle not recommended, except GNRH-agonists that can be used as a downregulation therapy before IVF or surgery. Likewise with pain, complementary therapies are not yet considered as a therapeutic option because of the lack of evidence.

Availability of data and materials

Data sharing is not applicable to this article as no datasets were generated or analysed during the current study.

Abbreviations

College National des Gynecologues et Obstetriciens Francais

National German Guideline

Society of Obstetricians and Gynaecologists of Canada

American College of Obstetricians and Gynecologists

American Society for Reproductive Medicine

National Institute for Health and Care Excellence

World Endometriosis Society

European Society of Human Reproduction and Embryology

Intrauterine system

Gonadotropin-releasing hormone

Selective estrogen receptor modulators

Selective progesterone receptor modulators

Randomized control trial

Nonsteroidal anti-inflammatory drugs

Hormone replacement therapy

Combined oral contraceptive pill

Laparoscopic uterine nerve ablation

Presacral neurectomy

Deep infiltrating endometriosis

Follicle-stimulating hormone

Luteinizing hormone

Transcutaneous Electrical Nerve Stimulation

Shafrir AL, Farland LV, Shah DK, Harris HR, Kvaskoff M, Zondervan K, et al. Risk for and consequences of endometriosis: A critical epidemiologic review. Best Pract Res Clin Obstet Gynaecol. 2018;51:1–15.

Article   CAS   PubMed   Google Scholar  

Simoens S, Hummelshoj L, Dunselman G, Brandes I, Dirksen C, D’Hooghe T, et al. Endometriosis cost assessment (the EndoCost study): a cost-of-illness study protocol. Gynecol Obstet Invest. 2011;71(3):170–6.

Article   PubMed   Google Scholar  

Hirsch M, Begum MR, Paniz É, Barker C, Davis CJ, Duffy J. Diagnosis and management of endometriosis: a systematic review of international and national guidelines. BJOG. 2018;125(5):556–64.

Collinet P, Fritel X, Revel-Delhom C, Ballester M, Bolze PA, Borghese B, et al. Management of endometriosis: CNGOF-HAS practice guidelines (short version). Gynecol Obstet Fertil Senol. 2018;46(3):144–55.

CAS   PubMed   Google Scholar  

Ulrich U, Buchweitz O, Greb R, Keckstein J, von Leffern I, Oppelt P, et al. National German Guideline (S2k): Guideline for the Diagnosis and Treatment of Endometriosis: Long Version—AWMF Registry No. 015-045. Geburtshilfe Frauenheilkd. 2014;74(12):1104–18.

Corrections to: "SOGC Clinical Practice Gynaecology Committee. Endometriosis: diagnosis and management. SOGC Clinical Practice Guideline No. 244, July 2010. J Obstet Gynaecol Can 2010;32(Suppl):S1-S33.". J Obstet Gynaecol Can. 2010;32(9):825.

Practice bulletin no. 114: management of endometriosis. Obstet Gynecol. 2010;116(1):223-36.

Practice Committee of the American Society for Reproductive M. Endometriosis and infertility: a committee opinion. Fertil Steril. 2012;98(3):591–8.

Practice Committee of the American Society for Reproductive M. Treatment of pelvic pain associated with endometriosis: a committee opinion. Fertil Steril. 2014;101(4):927–35.

Diagnosis and management of endometriosis: summary of NICE guidance. BMJ. 2017;358:j4227.

Johnson NP, Hummelshoj L, World Endometriosis Society Montpellier C. Consensus on current management of endometriosis. Hum Reprod. 2013;28(6):1552–68.

Dunselman GA, Vermeulen N, Becker C, Calhaz-Jorge C, D’Hooghe T, De Bie B, et al. ESHRE guideline: management of women with endometriosis. Hum Reprod. 2014;29(3):400–12.

Jacobson TZ, Duffy JM, Barlow D, Koninckx PR, Garry R. Laparoscopic surgery for pelvic pain associated with endometriosis. Cochrane Database Syst Rev. 2009(4):CD001300.

Restaino S, Mereu L, Finelli A, Spina MR, Marini G, Catena U, et al. Robotic surgery vs laparoscopic surgery in patients with diagnosis of endometriosis: a systematic review and meta-analysis. J Robot Surg. 2020.

Chapron C, Jacob S, Dubuisson JB, Vieira M, Liaras E, Fauconnier A. Laparoscopically assisted vaginal management of deep endometriosis infiltrating the rectovaginal septum. Acta Obstet Gynecol Scand. 2001;80(4):349–54.

Horne AW, Daniels J, Hummelshoj L, Cox E, Cooper KG. Surgical removal of superficial peritoneal endometriosis for managing women with chronic pelvic pain: time for a rethink? BJOG. 2019;126(12):1414–6.

Article   CAS   PubMed   PubMed Central   Google Scholar  

Bafort C, Beebeejaun Y, Tomassetti C, Bosteels J, Duffy JM. Laparoscopic surgery for endometriosis. Cochrane Database Syst Rev. 2020;10:CD011031.

PubMed   Google Scholar  

Duffy JM, Arambage K, Correa FJ, Olive D, Farquhar C, Garry R, et al. Laparoscopic surgery for endometriosis. Cochrane Database Syst Rev. 2014;4:CD011031.

Google Scholar  

Hart RJ, Hickey M, Maouris P, Buckett W. Excisional surgery versus ablative surgery for ovarian endometriomata. Cochrane Database Syst Rev. 2008;2:CD004992.

Carmona F, Martinez-Zamora MA, Rabanal A, Martinez-Roman S, Balasch J. Ovarian cystectomy versus laser vaporization in the treatment of ovarian endometriomas: a randomized clinical trial with a five-year follow-up. Fertil Steril. 2011;96(1):251–4.

Kalaitzopoulos DR, Mitsopoulou A, Iliopoulou SM, Daniilidis A, Samartzis EP, Economopoulos KP. Association between endometriosis and gynecological cancers: a critical review of the literature. Arch Gynecol Obstet. 2020;301(2):355–67.

Carrillo L, Seidman DS, Cittadini E, Meirow D. The role of fertility preservation in patients with endometriosis. J Assist Reprod Genet. 2016;33(3):317–23.

Raffi F, Metwally M, Amer S. The impact of excision of ovarian endometrioma on ovarian reserve: a systematic review and meta-analysis. J Clin Endocrinol Metab. 2012;97(9):3146–54.

Working group of Esge E, Wes, Keckstein J, Becker CM, Canis M, Feki A, et al. Recommendations for the surgical treatment of endometriosis. Part 2: deep endometriosis. Hum Reprod Open. 2020;2020(1):hoaa002.

Rizk B, Fischer AS, Lotfy HA, Turki R, Zahed HA, Malik R, et al. Recurrence of endometriosis after hysterectomy. Facts Views Vis Obgyn. 2014;6(4):219–27.

CAS   PubMed   PubMed Central   Google Scholar  

Vercellini P, Barbara G, Abbiati A, Somigliana E, Vigano P, Fedele L. Repetitive surgery for recurrent symptomatic endometriosis: what to do? Eur J Obstet Gynecol Reprod Biol. 2009;146(1):15–21.

Fedele L, Bianchi S, Zanconato G, Berlanda N, Borruto F, Frontino G. Tailoring radicality in demolitive surgery for deeply infiltrating endometriosis. Am J Obstet Gynecol. 2005;193(1):114–7.

Practice Committee of American Society for Reproductive Medicine in collaboration with Society of Reproductive S. Pathogenesis, consequences, and control of peritoneal adhesions in gynecologic surgery: a committee opinion. Fertil Steril. 2013;99(6):1550–5.

Ahmad G, Kim K, Thompson M, Agarwal P, O'Flynn H, Hindocha A, et al. Barrier agents for adhesion prevention after gynaecological surgery. Cochrane Database Syst Rev. 2020;3:CD000475.

Proctor ML, Latthe PM, Farquhar CM, Khan KS, Johnson NP. Surgical interruption of pelvic nerve pathways for primary and secondary dysmenorrhoea. Cochrane Database Syst Rev. 2005;4:CD001896.

Vercellini P, Aimi G, Busacca M, Apolone G, Uglietti A, Crosignani PG. Laparoscopic uterosacral ligament resection for dysmenorrhea associated with endometriosis: results of a randomized, controlled trial. Fertil Steril. 2003;80(2):310–9.

Kim JJ, Kurita T, Bulun SE. Progesterone action in endometrial cancer, endometriosis, uterine fibroids, and breast cancer. Endocr Rev. 2013;34(1):130–62.

Klipping C, Duijkers I, Remmers A, Faustmann T, Zurth C, Klein S, et al. Ovulation-inhibiting effects of dienogest in a randomized, dose-controlled pharmacodynamic trial of healthy women. J Clin Pharmacol. 2012;52(11):1704–13.

Strowitzki T, Marr J, Gerlinger C, Faustmann T, Seitz C. Dienogest is as effective as leuprolide acetate in treating the painful symptoms of endometriosis: a 24-week, randomized, multicentre, open-label trial. Hum Reprod. 2010;25(3):633–41.

Harada T, Momoeda M, Taketani Y, Aso T, Fukunaga M, Hagino H, et al. Dienogest is as effective as intranasal buserelin acetate for the relief of pain symptoms associated with endometriosis–a randomized, double-blind, multicenter, controlled trial. Fertil Steril. 2009;91(3):675–81.

Buggio L, Somigliana E, Barbara G, Frattaruolo MP, Vercellini P. Oral and depot progestin therapy for endometriosis: towards a personalized medicine. Expert Opin Pharmacother. 2017;18(15):1569–81.

Vigano P, Somigliana E, Vercellini P. Levonorgestrel-releasing intrauterine system for the treatment of endometriosis: biological and clinical evidence. Womens Health (Lond). 2007;3(2):207–14.

Article   CAS   Google Scholar  

Song SY, Park M, Lee GW, Lee KH, Chang HK, Kwak SM, et al. Efficacy of levonorgestrel releasing intrauterine system as a postoperative maintenance therapy of endometriosis: A meta-analysis. Eur J Obstet Gynecol Reprod Biol. 2018;231:85–92.

Brown J, Crawford TJ, Datta S, Prentice A. Oral contraceptives for pain associated with endometriosis. Cochrane Database Syst Rev. 2018;5:CD001019.

Hughes E, Brown J, Collins JJ, Farquhar C, Fedorkow DM, Vandekerckhove P. Ovulation suppression for endometriosis. Cochrane Database Syst Rev. 2007;3:CD000155.

Brown J, Crawford TJ, Allen C, Hopewell S, Prentice A. Nonsteroidal anti-inflammatory drugs for pain in women with endometriosis. Cochrane Database Syst Rev. 2017;1:CD004753.

Brown J, Pan A, Hart RJ. Gonadotrophin-releasing hormone analogues for pain associated with endometriosis. Cochrane Database Syst Rev. 2010;12:CD008475.

Decleer W, Osmanagaoglu K, Verschueren K, Comhaire F, Devroey P. RCT to evaluate the influence of adjuvant medical treatment of peritoneal endometriosis on the outcome of IVF. Hum Reprod. 2016;31(9):2017–23.

Surrey ES, Hornstein MD. Prolonged GnRH agonist and add-back therapy for symptomatic endometriosis: long-term follow-up. Obstet Gynecol. 2002;99(5 Pt 1):709–19.

Carr B, Dmowski WP, O’Brien C, Jiang P, Burke J, Jimenez R, et al. Elagolix, an oral GnRH antagonist, versus subcutaneous depot medroxyprogesterone acetate for the treatment of endometriosis: effects on bone mineral density. Reprod Sci. 2014;21(11):1341–51.

Article   PubMed   PubMed Central   Google Scholar  

Pavone ME, Bulun SE. Aromatase inhibitors for the treatment of endometriosis. Fertil Steril. 2012;98(6):1370–9.

Ferrero S, Evangelisti G, Barra F. Current and emerging treatment options for endometriosis. Expert Opin Pharmacother. 2018;19(10):1109–25.

Polyzos NP, Fatemi HM, Zavos A, Grimbizis G, Kyrou D, Velasco JG, et al. Aromatase inhibitors in post-menopausal endometriosis. Reprod Biol Endocrinol. 2011;9:90.

Godin R, Marcoux V. Vaginally Administered Danazol: An Overlooked Option in the Treatment of Rectovaginal Endometriosis? J Obstet Gynaecol Can. 2015;37(12):1098–103.

Brown J, Farquhar C. Endometriosis: an overview of Cochrane Reviews. Cochrane Database Syst Rev. 2014;3:CD009590.

Fu J, Song H, Zhou M, Zhu H, Wang Y, Chen H, et al. Progesterone receptor modulators for endometriosis. Cochrane Database Syst Rev. 2017;7:CD009881.

Kamencic H, Thiel JA. Pentoxifylline after conservative surgery for endometriosis: a randomized, controlled trial. J Minim Invasive Gynecol. 2008;15(1):62–6.

Koninckx PR, Craessaerts M, Timmerman D, Cornillie F, Kennedy S. Anti-TNF-alpha treatment for deep endometriosis-associated pain: a randomized placebo-controlled trial. Hum Reprod. 2008;23(9):2017–23.

Mira TAA, Buen MM, Borges MG, Yela DA, Benetti-Pinto CL. Systematic review and meta-analysis of complementary treatments for women with symptomatic endometriosis. Int J Gynaecol Obstet. 2018;143(1):2–9.

Proctor ML, Murphy PA, Pattison HM, Suckling J, Farquhar CM. Behavioural interventions for primary and secondary dysmenorrhoea. Cochrane Database Syst Rev. 2007;3:CD002248.

Kalaitzopoulos DR, Lempesis IG, Athanasaki F, Schizas D, Samartzis EP, Kolibianakis EM, et al. Association between vitamin D and endometriosis: a systematic review. Hormones (Athens). 2020;19(2):109–21.

Article   Google Scholar  

Nirgianakis K, Egger K, Kalaitzopoulos DR, Lanz S, Bally L, Mueller MD. Effectiveness of dietary interventions in the treatment of endometriosis: a systematic review. Reprod Sci. 2021. https://doi.org/10.1007/s43032-020-00418-w .

Download references

Acknowledgements

A part of this publication was presented as an E-poster at the ESGE 28 th Annual Congress.

No funding or financial support has been allocated for this project.

Author information

Authors and affiliations.

Department of Gynecology and Obstetrics, Cantonal Hospital Schaffhausen, Geissbergstrasse 81, 8208, Schaffhausen, Switzerland

Dimitrios Rafail Kalaitzopoulos, Nicolas Samartzis, Georgios N. Kolovos & Markus Eberhard

Department of Obstetrics and Gynecology, Hippokratio Hospital, Aristotle University of Thessaloniki, Thessaloniki, Greece

Evangelia Mareti, Kostantinos Dinas & Angelos Daniilidis

Department of Gynecology, University Hospital Zurich, Zurich, Switzerland

Dimitrios Rafail Kalaitzopoulos & Eleftherios Pierre Samartzis

You can also search for this author in PubMed   Google Scholar

Contributions

DRK, NS, KD, AD: Project development, Data collection, Manuscript writing. GNK, EPS, EM: Data collection, Manuscript editing. ME: Supervision, Manuscript editing. All authors have read and approved the manuscript.

Corresponding author

Correspondence to Dimitrios Rafail Kalaitzopoulos .

Ethics declarations

Ethics approval and consent to participate.

Not applicable.

Consent for publication

Competing interests.

The authors declare that they have no competing interests.

Additional information

Publisher's note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Cite this article.

Kalaitzopoulos, D.R., Samartzis, N., Kolovos, G.N. et al. Treatment of endometriosis: a review with comparison of 8 guidelines. BMC Women's Health 21 , 397 (2021). https://doi.org/10.1186/s12905-021-01545-5

Download citation

Received : 12 November 2020

Accepted : 18 November 2021

Published : 29 November 2021

DOI : https://doi.org/10.1186/s12905-021-01545-5

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Endometriosis
• Infertility
• Conservative treatment
• Surgical treatment

BMC Women's Health

ISSN: 1472-6874

• General enquiries: [email protected]

• - Google Chrome

Intended for healthcare professionals

• My email alerts
• BMA member login
• Username * Password * Forgot your log in details? Need to activate BMA Member Log In Log in via OpenAthens Log in via your institution

Search form

• Advanced search
• Search responses
• Search blogs
• Pathophysiology,...

Pathophysiology, diagnosis, and management of endometriosis

• Related content
• Peer review
• Andrew W Horne , professor of gynaecology and reproductive sciences 1 ,
• Stacey A Missmer , professor of obstetrics, gynaecology, and reproductive biology , adjunct professor of epidemiology 2 3
• 1 EXPPECT Edinburgh and MRC Centre for Reproductive Health, University of Edinburgh, Edinburgh, UK
• 2 Michigan State University, Grand Rapids, MI, USA
• 3 Harvard T.H. Chan School of Public Health, Boston, MA, USA
• Correspondence to: A W Horne andrew.horne{at}ed.ac.uk

Endometriosis affects approximately 190 million women and people assigned female at birth worldwide. It is a chronic, inflammatory, gynecologic disease marked by the presence of endometrial-like tissue outside the uterus, which in many patients is associated with debilitating painful symptoms. Patients with endometriosis are also at greater risk of infertility, emergence of fatigue, multisite pain, and other comorbidities. Thus, endometriosis is best understood as a condition with variable presentation and effects at multiple life stages. A long diagnostic delay after symptom onset is common, and persistence and recurrence of symptoms despite treatment is common. This review discusses the potential genetic, hormonal, and immunologic factors that lead to endometriosis, with a focus on current diagnostic and management strategies for gynecologists, general practitioners, and clinicians specializing in conditions for which patients with endometriosis are at higher risk. It examines evidence supporting the different surgical, pharmacologic, and non-pharmacologic approaches to treating patients with endometriosis and presents an easy to adopt step-by-step management strategy. As endometriosis is a multisystem disease, patients with the condition should ideally be offered a personalized, multimodal, interdisciplinary treatment approach. A priority for future discovery is determining clinically informative sub-classifications of endometriosis that predict prognosis and enhance treatment prioritization.

Introduction

Endometriosis is a chronic, inflammatory, gynecologic disease marked by the presence of endometrial-like tissue outside the uterus, which affects approximately 10% of women during their reproductive years—190 million women worldwide. 1 In many patients, it is associated with chronic painful symptoms and other comorbidities, including infertility. 2 The health burden of endometriosis includes chronic pain and significant lifetime costs of $27 855 per year per patient, 3 accumulating to annual healthcare costs for endometriosis of approximately $22bn in the US alone and £12.5bn in the UK in treatment, work loss, and healthcare costs. 4 Although more than 50% of adults diagnosed as having endometriosis report onset of severe pelvic pain during adolescence, 5 most young women with endometriosis do not receive timely treatment. Almost 60% of women will see three or more clinicians before a diagnosis of endometriosis is made after an average of seven years with symptoms. 6 Women with endometriosis lose on average 11 hours of work per week, similar to other chronic conditions including type 2 diabetes, Crohn’s disease, and rheumatoid arthritis. 7 Adolescents are at risk of having inadequately remediated symptoms during prime years for social development and life planning, 8 and women must be resilient against inadequately remediated symptoms and emerging comorbidities. Women, healthcare providers, and scientists would benefit from conceptualizing endometriosis as a condition that can affect the whole woman. This includes a better understanding of the risk of subsequent development of autoimmune disease, cancer, and cardiovascular disease and a whole health approach to monitoring and wellbeing. 9

This review is aimed at general practitioners and pediatric specialists who are most likely to interact with patients as signs and symptoms of endometriosis first emerge and from whom early attention and empiric treatment may dramatically shorten the burden; gynecology specialists for whom myths must be dispelled and who must be aware of state of the art knowledge about patient centered treatments; endometriosis specialists who care for women’s endometriosis associated symptoms across the life course; and clinical researchers and scientists who must be inspired to bring their expertise and creativity to answer the fundamental enigmas of endometriosis etiology, informative sub-phenotyping, and novel patient centered treatment.

In this review, we use the terms “woman” and “women.” However, it is important to note that endometriosis can affect all people assigned female at birth.

Sources and selection criteria

We searched PubMed for studies using the term “endometriosis.” We considered all peer reviewed studies published in the English language between 1 January 2010 and 28 February 2022. We also identified references from international guidelines on endometriosis published during this time period. We selected relevant publications outside this timeline on the basis of review of the bibliography. We predefined the priority of study selection for this review according to the level of the evidence (meta-analyses, systematic or scoping reviews, randomized controlled trials (RCTs), prospective cohort studies, case-control studies, cross sectional studies; a priori exclusion of case series and case reports), by sample size (we prioritized studies with larger sample size as well as studies providing precision statistics), by population sampling (we prioritized studies with more diverse populations or with declared sub-population design over narrow population samples), and publication date (we prioritized more recent studies).

Overall quality of evidence

Much of the knowledge on endometriosis is based on concepts in early stages of evidence development or on sparse literature. Many studies include single hospital or clinic population samples with small total sample sizes and disproportionately representing patients presenting with infertility compared with endometriosis associated pain. 10

Beyond the limitations of the existing literature, fundamental problems with the diagnosis of endometriosis must be overcome before we can adequately define endometriosis, its prevalence, biologically and clinically informative sub-phenotypes, and its response to treatment and long term prognosis. 11 The lack of a non-invasive diagnostic modality creates insurmountable diagnostic biases driven by characteristics of those patients who can and those who cannot access a definitive surgical or imaging diagnosis and at what point in their endometriosis journey the condition is diagnosed.

Ovarian endometrioma or deep endometriosis can be diagnosed through imaging if the patient is geographically, economically, and socially able to achieve referral to and evaluation from an experienced imaging specialist. 12 13 For women with superficial peritoneal disease, definitive diagnosis by means of surgical evaluation is limited to those with symptoms deemed sufficiently severe and life affecting and resistant to empiric treatment to justify the inherent risks of surgery. Even among patients with symptoms deemed to have enough of an effect to warrant referral for a surgical evaluation, stigma, 14 disbelief and misperceptions of pain or fertility that can be driven by racism or elitism, 15 and geographic and economic barriers to accessing endometriosis focused surgeons remain.

Beyond access to an appropriate, skilled physician, the wide range of symptoms associated with endometriosis—many of which are stigmatized or normalized 14 16 —reduces the likelihood of referral and increases time to referral to appropriate specialists. 5 6 11 17 The bias in diagnosis itself may be influenced by variations in clinical symptoms among different populations not adequately captured or appreciated by standard clinical definitions or may represent implicit bias in healthcare, leading to an alternate interpretation of the same symptoms affecting the likelihood of diagnosis. This delay to diagnosis affects patients directly, but it also results in most scientific studies capturing patients’ characteristics, biologic samples, and biomarker measurements far into the natural pathophysiologic progression of the disease. Moreover, studies from African and Asian countries are considerably under-represented compared with European and North American countries. 10 High quality studies from these regions and development of a sensitive non-invasive diagnostic tool might alter existing global prevalence and incidence estimates and may reveal a more comprehensive view of what early milieu, signs and symptoms, and long term health outcomes are truly attributable to endometriosis.

Definition, symptoms, and classification

Among women with the condition, endometriosis has a highly heterogeneous presentation of visualized endometriotic lesions, multisystem symptom presentation, and comorbid conditions ( fig 1 ).

Highly varied presentation of endometriosis

• Download figure
• Open in new tab
• Download powerpoint

Surgically visualized macro sub-phenotypes of endometriosis

Endometriosis is defined by the presence of endometrium-like epithelium and/or stroma (lesions) outside the endometrium and myometrium, usually with an associated inflammatory process. 18 Most endometriosis is found within the abdominal cavity, and it exists as three subtypes: superficial peritoneal endometriosis (accounting for around 80% of endometriosis), ovarian endometriosis (cysts or “endometrioma”), and deep endometriosis 1 19 ( box 1 ; fig 2 ). All forms of endometriosis can be found together, not solely as separate entities. Although not a subtype, endometriosis situated inside the bowel wall is termed “bowel endometriosis.” It mostly affects the rectosigmoid area, but lesions can also be found in other parts of the gastrointestinal system, including the appendix. Endometriosis involving the detrusor muscle and/or the bladder epithelium is termed “bladder endometriosis.” Extra-abdominal (replacing the older term “extra-pelvic”) endometriosis is used to describe any endometriosis lesions found outside of the abdomen (for example, thoracic endometriosis). 20 Iatrogenic endometriosis describes endometriosis thought to be arising from direct or indirect dissemination of endometrium following surgery (for example, cesarean scar endometriosis).

Nomenclature 18

Superficial peritoneal endometriosis.

Endometrium-like tissue lesions involving the peritoneal surface with multiple appearances

Ovarian endometriosis

Endometrium-like tissue lesions in the form of ovarian cysts containing endometrium-like tissue and dark blood stained fluid (endometrioma or “chocolate cysts”)

Deep endometriosis

Endometrium-like tissue lesions extending on or infiltrating the peritoneal surface (usually nodular, invading into adjacent structures, and associated with fibrosis)

Extra-abdominal endometriosis

Endometrium-like tissue outside the abdominal cavity (for example, thoracic, umbilical, brain endometriosis)

Iatrogenic endometriosis

Direct or indirect dissemination of endometrium following surgery (for example, cesarean scar endometriosis)

Surgical images of endometriosis sub-phenotypes

Adenomyosis is not a sub-phenotype of endometriosis, 21 although it is characterized by endometrial tissue surrounded by smooth muscle cells within the myometrium. 22 Symptoms include dysmenorrhea and heavy menstrual and/or abnormal uterine bleeding, 23 and a heterogeneous adenomyosis presentation is visualized with radiologic imaging or at hysterectomy that lacks an agreed terminology or classification system. 24 25 Evidence is emerging of tissue injury and repair mechanisms mediated by estradiol and inflammation. 25 26

Endometriosis associated symptoms

Endometriosis is often associated with a range of painful symptoms that include chronic pelvic pain (cyclical and non-cyclical), painful periods (dysmenorrhea), painful sex (dyspareunia), and pain on defecation (dyschezia) and urination (dysuria). 1 27 Their severity can range from mild to debilitating. Some women have no symptoms, others have episodic pelvic pain, and still others experience constant pain in multiple body regions. 28 A related observation is that some women transition between these categories, progressing from episodic and localized pain to that which is chronic, complex, and more difficult to treat. Furthermore, women with disease that is anatomically “severe” can have minimal symptoms and women with “minimal” evidence of endometriosis can have severe, life affecting symptoms. 1 19 In common with other chronic pain conditions, women with endometriosis often report experiencing fatigue and depression. Infertility is significantly more common in patients with endometriosis, with a doubling of risk compared with women without endometriosis. 2 Endometriosis is discovered in 30-50% of women who present for assisted reproductive treatment. 29 30

Endometriosis associated or high risk comorbidities

Endometriosis is certainly a multisystem condition, perhaps as a result of common pathogenesis or as a consequence of the chronic endogenous response to the presence of endometriotic lesions. 9 Although pelvic pain is the most common symptom of possible endometriosis, women with endometriosis also have a high risk of co-occurring or evolving multisite pain. 28 Patients with endometriosis have a higher risk of presentation with comorbid chronic pain conditions such as fibromyalgia, 31 32 33 migraines, 34 35 and also rheumatoid arthritis, 33 36 psoriatic arthritis, 37 and osteoarthritis. 36 38 Reports of back, bladder, or bowel pain are prevalent, 16 39 with dyschezia being potentially predictive of endometriosis. 40 Nearly 50% of women with bladder pain syndrome or interstitial cystitis have endometriosis. 41 42 Irritable bowel syndrome is a common co-occurring diagnosis that reinforces the importance of awareness of endometriosis among gastroenterologists. 43 44 45 These conditions may share a common cause, 46 they may arise together owing to shared environmental or genetic factors, and/or the occurrence of comorbid pain conditions could be due to changes in pain perception after repeated sensitization. 47 Research focused on disentangling the overlapping and independent pathways of these frequently co-occurring pain associated conditions is essential. 48 49

Women with endometriosis have a greater risk of presenting with other non-malignant gynecologic diseases, including uterine fibroids and adenomyosis. 50 51 They are also at greater risk of a subsequent diagnosis of malignancies, autoimmune diseases, early natural menopause, and cerebrovascular and cardiovascular conditions. 36 52 53 54 55 56 57 The hypothesized causal mechanisms for endometriosis discussed below are all thought to be enhanced by and/or result in chronic inflammation. Local and systemic chronic inflammation can directly activate afferent nociceptive fibers and promote pelvic pain, 58 although this does not entirely explain the heterogeneity in types and severity of painful symptoms that patients experience. Furthermore, endometriosis induced chronic inflammation and immune dysregulation may also contribute to the endometriosis associated subsequent risk of each of these comorbid conditions. 59 60

Although this multisystem effect reinforces the importance of knowledge of and attention to endometriosis from general practitioners and a myriad specialists for whole healthcare, the most prominent association, and the focus of the greatest volume of comorbidity research, is the elevated risk of ovarian cancer among women with endometriosis. A recent meta-analysis confirmed this association, 53 finding a nearly twofold greater relative risk of ovarian cancer among patients with endometriosis (summary relative risk (SRR) 1.93, 95% confidence interval 1.68 to 2.22; n=24 studies) that was strongest for clear cell (3.44, 2.82 to 4.42; n=5 studies) and endometrioid (2.33, 1.82 to 2.98; n=5 studies) histotypes. However, among these 24 studies, significant evidence existed of both heterogeneity across studies and publication bias (Egger’s and Begg’s P values <0.01). Clinicians need to reinforce that ovarian cancer is rare regardless of women’s endometriosis status 61 : the absolute lifetime risk in the general population is 1.3%, 62 and applying the risk estimate from the meta-analysis (SRR 1.9) gives an absolute lifetime risk for women with endometriosis of 2.5%, which is 1.2% higher than the absolute risk for women without endometriosis and still very low.

We should also recognize that coexisting gynecologic conditions such as adenomyosis and uterine fibroids, 50 as well as associations with endometrial cancer, 53 can be influenced by diagnostic biases and failure to distinguish between diagnoses in women undergoing hysterectomy and those in women with an intact uterus. 11 51 When attempting to infer a causal relation between endometriosis and other conditions, applying rigorous prospective temporality (rather than cross sectional co-occurrence) is particularly important for valid subsequent risk associations. 53 These studies need large study populations with well documented longitudinal data. A large impediment is the lack of routine, harmonized documentation of the characteristics of endometriosis and its absence from international classification of diseases coding. 63 64

Endometriosis classification systems

Several classification, staging, and reporting systems have been developed; 22 systems were published between 1973 and 2021. 65 The three most commonly used systems are the revised American Society for Reproductive Medicine (rASRM) classification (stages I-IV; where stage I is equivalent to “minimal” disease and stage 4 to “severe” disease), the ENZIAN (and newer #ENZIAN) classification, and the Endometriosis Fertility Index (EFI). 66 67 68 69 Many validation studies and reports on the implementation of the different systems have been published. The rASRM system (scored at surgery on the basis of the extent of visualized superficial peritoneal lesions, endometriomas, and adhesions) has been shown to have poor correlation with pain, 70 fertility outcomes, and prognosis, and the ENZIAN system (which additionally includes deep endometriosis) has been shown to have poor correlation with symptoms and infertility. 71 72 73 The EFI is a well validated clinical tool that predicts pregnancy rates after surgical staging of endometriosis, with ongoing evaluation to determine the predictive importance of the individual parameters included in the scoring algorithm as well as the effect of completeness of surgical treatment on pregnancy prediction. 74 Unfortunately, no international agreement exists on how to describe endometriosis or how to classify it. As most systems show no, or very little, correlation with patients’ symptoms and outcomes, this is further evidence of our lack of understanding of the physiology underlying the symptoms associated with endometriosis.

Epidemiology

The exact prevalence of endometriosis is unknown given diagnostic delays and barriers, and—perhaps consequently—it is extremely varied depending on the population and the indication for evaluation. A recent meta-analysis identified 69 studies describing the prevalence and/or incidence of endometriosis, among which 26 studies were general population samples, 17 were from regional/national hospitals or insurance claims systems, and the remaining 43 studies were conducted in single clinic or hospital settings. 10 The prevalence reported in general population studies ranged from 0.7% to 8.6%, whereas that reported in single clinic or hospital based studies ranged from 0.2% to 71.4%.

When defined by indications for diagnosis, the prevalence of endometriosis ranged from 15.4% to 71.4% among women with chronic pelvic pain, from 9.0% to 68.0% among women presenting with infertility, and from 3.7% to 43.3% among women undergoing tubal sterilization. Few studies have investigated the incidence and prevalence of endometriosis specifically among adolescents. The reported prevalence of visually confirmed endometriosis among adolescents with pelvic pain ranges from 25% to 100%, with an average of 49% among adolescents with chronic pelvic pain and 75% among those unresponsive to medical treatment. 75 The Ghiasi meta-analysis reported a decrease in recorded prevalence across the past 30 years. 10 Speculating, this may be due to more rapid and more ubiquitous embracing of empiric treatment of symptom, forgoing or delaying definitive imaging or surgical diagnosis, a patient centered approach that has been ratified by the most recent European endometriosis guideline. 13 This hypothesis is supported by a recent report from a large US health system’s electronic medical records database that observed a decline from 2006 through 2015 in incidence rates for endometriosis (from 30.2 per 10 000 person years in 2006 to 17.4 per 10 000 person years in 2015) but an increase in documentation of chronic pelvic pain diagnoses (from 3.0% to 5.6%). 76

Pathophysiology

Heritability and genetics.

Estimates from twin studies suggest 47-51% total heritability of endometriosis, with 26% estimated to be from genetic variation. 77 78 79 To date, nine genome-wide association studies have been reported. 59 The largest study so far, using 17 045 cases and 191 596 controls, has identified 19 single nucleotide polymorphisms, most of which were more strongly associated with rASRM stage III/IV, rather than stage I/II, explaining 1.75% of risk for endometriosis. 80 Consistent with other complex diseases with multifactorial origins, no high penetrance susceptibility genes for endometriosis have yet been identified. 62 The loci discovered to date are almost all located in intergenic regions that are known to play a role in the regulation of expression of target genes yet to be identified. The critical next steps in genetic discovery are to identify additional genes that reveal novel pathophysiological pathways and also emerge to better define the underpinnings of variation in symptoms (in particular, pain types and infertility and treatment response predictors) and also gene expression correlated with comorbid autoimmune, cancer, and cardiovascular conditions. 62

Reflux of endometrial tissue fragments/cells and protein rich fluid through the fallopian tubes into the pelvis during menstruation is considered the most likely explanation for why endometriotic lesions form within the peritoneal cavity, although this mechanism is not sufficient as nearly all women experience retrograde menstruation. 81 82 Additional postulated origins include celomic metaplasia and lymphatic and vascular metastasis. Scientific avenues exploring contributions of interacting endocrine, immunologic, proinflammatory, and proangiogenic processes are drawing curiosity and expertise from varied disciplines with application of state of the art technologies. 59 Retrograde menstruation of stem cells contributes to the establishment of endometriosis, 83 whereas bone marrow stem cells contribute to the continued growth of endometriosis lesions. 84 85 Bone marrow derived stem cells may be responsible for those cases of endometriosis outside of the abdominal cavity. 86

Studies exploring why lesions develop in some, but not all, women have detected changes in the endometrial tissue as well as in the peritoneal fluid and cells lining the cavity. Eutopic endometrial tissue has a significantly different immune profile in women with endometriosis compared with those without it. 87 However, the extent to which this inflammation is a cause or an effect of endometriosis remains unclear. Aberrant inflammation could have an effect on the development of endometriosis lesions and disease progression in various ways, including immune angiogenesis and immune-endocrine interaction. 59 60 Specifically, some of the proposed pathways include altered production of inflammatory cytokines by immune cells in lesions or by endometrial cells themselves involving decreased immune clearance of abnormal endometrial cells and consequent seeding and development of lesions, increased likelihood of adhesion to mesothelial cells due to pro-invasion inflammatory milieu, inflammation promoted proliferation of endometrial cells, and inflammation promoted reduction in apoptosis of endometrial cells. 88 Analysis of eutopic endometrium from women with endometriosis has identified altered expression of genes implicated in the inflammation/immune response, angiogenesis, and steroid responsiveness (progesterone “resistance”). 89 Shed menstrual tissue contains high concentrations of pro-inflammatory cytokines, proteases, and immune cells, all of which may influence the peritoneal microenvironment after reflux. Stem/progenitor cells have been identified in the endometrium and are thought to survive and implant onto the peritoneum, contributing to lesions. 83 Mesothelial cells line the pelvic peritoneal cavity, and changes in their function in women with endometriosis, including altered morphology and metabolism (switch to aerobic glycolysis) 90 and production of factors that promote immune cell recruitment and angiogenesis are all thought to favor survival and establishment of lesions. 91 Physiological hormonal fluctuations in women induce cyclical episodes of cell proliferation, inflammation, injury, and repair within lesions that favor fibroblast to myofibroblast differentiation and fibrosis.

Mechanisms of endometriosis associated pain

The development of a new blood supply and associated nerves (neuroangiogenesis) is considered key to the establishment of endometriotic lesions and the activation of peripheral pain pathways ( fig 3 ). 92 Sensory C, sensory Ad, cholinergic, and adrenergic nerve fibers have all been detected in lesions. Estrogens can promote crosstalk between immune cells and nerves within lesions, increasing expression of nociceptive ion channels such as the transient receptor potential cation channel subfamily V member 1. 93 Factors that promote inflammation and nerve growth, such as nerve growth factor, tumor necrosis factor α, and interleukin 1-β, are increased in the peritoneal fluid of women with endometriosis and may exacerbate a neuroinflammatory cascade. Consistent with other conditions associated with chronic pain, endometriosis is associated with unique, and sometimes disease specific, alterations in the peripheral and central nervous systems, including changes in the volume of regions of the brain and in brain biochemistry. 94 Increased risk of central sensitization may partially explain why approximately 30% of patients with endometriosis will develop chronic pelvic pain that is unresponsive to conventional treatments, including surgery. 95 Through this central process, patients can experience reduced pain thresholds, increased responsiveness and length of aftereffects to noxious stimuli, and expansion of the receptive field so that input from non-injured tissue may elicit pain. 46 47 Among endometriosis patients with central sensitization, the removal of the endometriotic lesions is unlikely to result in adequate pain remediation owing to continued activation of the central nervous system. 96 97 Thus, endometriosis associated pain does not neatly fall into one of the three main categories of chronic pain (that is, nociceptive, neuropathic, or nociplastic), 98 99 100 and it likely has a mixed pain phenotype or sits somewhere along a continuum of these pain phenotypes. For example, some patients have primarily nociceptive or neuropathic pain, others have primarily nociplastic pain, and the rest have a mixed phenotype with variable contributions of nociceptive, neuropathic, and nociplastic pain.

Pathophysiology of endometriosis: (1) potential factors contributing to endometriosis associated pain; (2) potential mechanisms of endometriosis associated infertility; (3) local factors involved in the development of an endometriosis lesion; (4) role of the eutopic endometrium in the development of an endometriosis lesion. CNS=central nervous system; PNS=peripheral nervous system

Mechanisms of endometriosis associated infertility

Endometriosis may impair fertility through multiple pathways, including peritoneal inflammation and endocrine derangements, which interfere with the follicular environment and consequently affect ovarian function and ultimately reduce oocyte competence. 101 Several studies of women undergoing in vitro fertilization have documented lower oocyte yield or ovarian reserve among women with endometriosis compared with those with other infertility diagnoses. 102 103 A recent study observed lower oocyte yield among endometrioma affected ovaries but not among the contralateral ovaries that were unaffected by endometriosis compared with unexposed ovaries from women with no evidence of endometriosis. 104 In addition, although unproven, anatomical distortion and adhesions caused by endometriosis, particularly in stage III-IV disease, seem likely to reduce the chance of natural conception.

No way to prevent endometriosis is known. Enhanced awareness, followed by early diagnosis and management, may slow or halt the natural progression of the disease and reduce the long term burden of painful symptoms, including possibly the risk of central sensitization, but no cure exists. Furthermore, the evidence for modifiable risk factors for endometriosis remains unacceptably sparse. 12 Critically needed are large scale longitudinal studies that can quantify modifiable exposures in girls and young women in the pre-diagnostic, and ideally the pre-symptomatic, window that are then explored further in humans, 105 106 107 as well as in experimental models, to determine the physiologic pathways defined by causal effects on the epigenome, transcriptome, proteome, and metabolome. To date, few risk factors have been robustly replicated in multiple populations, with the most consistently associated with endometriosis including müllerian anomalies, low birth weight and lean body size, early age at menarche, short menstrual cycles, and nulliparity. 1 11 Less research has supported associations with endocrine disrupting toxins including diethystilbestrol. 108

Clinical course

A critical aspect of care for women with endometriosis is that associated symptoms progress and recede over the life course, sometimes in response to treatment and sometimes with age or altered environment in pathways that we do not yet understand ( fig 4 ). For example, pain remediation is often a priority among adolescents, 109 whereas older women may be focused on fertility or on life affecting fatigue. 8 110 Furthermore, a long held belief that endometriosis and its symptoms do not occur in adolescents and end at menopause was erroneous. However, the years of perimenopause can be a time of increased pelvic pain, 111 112 with particular attention needing to be paid to symptom management that may include an unexpected return of pain in those patients for whom a treatment regimen had been successful during premenopause. 113 Clinicians need to focus across the life course on patient centered care, engaging in a dialogue to capture evolving symptomatology but also to collaborate on what symptoms are of most importance to the patient at this life stage. 110 Importantly, all that we believe we know about endometriosis is limited to the characteristics and natural history of those women who successfully obtain a diagnosis. To whatever extent asymptomatic or incidental findings have influenced the diagnostic population or to whatever extent health disparities or biases regarding symptom belief or access to pain or infertility care have limited or skewed those diagnosed, our elucidation of the true signs and symptoms and prognosis of endometriosis will evolve as care and access to it improves. 11

Endometriosis risk, establishment, and multisystem effects encompassing evolution across the life course

Diagnosis and monitoring

Although endometriosis has a highly variable presentation, steps can be recommended for decision making by general practitioners and gynecologists to approach a “working diagnosis” of probable endometriosis, implement treatment to remediate endometriosis associated symptoms, and consider multi-specialty collaboration for patient centered whole healthcare ( fig 5 ).

Flowchart for a step-by-step approach to patients with suspected endometriosis (adapted from flowcharts in the NICE 114 and ESHRE 13 endometriosis guidelines). *Imaging does not rule out endometriosis; if “negative” imaging but symptoms highly suggestive of endometriosis, consider “working diagnosis” of probable endometriosis. †General practitioners should monitor for emergence of signs of conditions associated with endometriosis and involve/refer to appropriate specialist (eg, gastroenterologist, cardiologist, rheumatologist, psychologist, oncologist). ‡Ideally within accredited specialist endometriosis center

“Red flag” symptoms and signs

The diagnosis of endometriosis should be considered in women (including girls aged 17 and under) presenting with one (or more) of the following symptoms or signs: chronic pelvic pain with or without cyclic flares, dysmenorrhea (affecting daily activities and quality of life), deep dyspareunia, cyclical gastrointestinal symptoms (particularly dyschezia), cyclical urinary symptoms (particularly hematuria or dysuria), or infertility in association with one (or more) of the preceding symptoms or signs. 114 Shoulder tip pain (pain under the shoulder blade), catamenial pneumothorax, cyclical cough/hemoptysis/chest pain, and cyclical scar swelling/pain can indicate endometriosis at extra-abdominal sites. 13 40 115 116 Fatigue is commonly reported by women with endometriosis. An abdomino-pelvic examination may help to identify ovarian and deep disease. 117

Diagnostic biomarkers

Many research studies and Cochrane reviews have assessed potential biomarkers for endometriosis, 118 119 120 with the ultimate goal of reducing the delay that exists in diagnosing endometriosis. Unfortunately, all of the candidates investigated to date have proven non-specific or unreliable, making them inappropriate for routine clinical use.

Imaging to diagnose endometriosis

Ultrasonography and magnetic resonance imaging (ideally two dimensional, T2 weighted sequences without fat suppression) can be used to diagnose endometriosis preoperatively, but the absence of findings on imaging does not exclude endometriosis, particularly superficial peritoneal disease. 121 122 Nevertheless, the ENDO Study enrolled 131 women from the general population who had not presented for gynecologic evaluation, among whom magnetic resonance imaging was used to diagnose endometriosis in 11%. 123 Although the sensitivity of transvaginal ultrasonography is maximized only for endometriomas, technological and training advances are improving detection of all sub-phenotypes of endometriotic lesions. 124 125 Saline infusion sonoPODography is a novel technique that may be able to diagnose superficial peritoneal endometriosis on ultrasonography, although it needs to be validated. 126

Laparoscopic diagnosis and appearance of endometriosis

In patients with suspected endometriosis, in whom imaging has shown no obvious pelvic pathology or for whom empirical treatment has been unsuccessful, laparoscopy is recommended for diagnosis. Laparoscopy for endometriosis should always involve a comprehensive exploration of the abdominal and pelvic contents. Histopathological confirmation is ideal; however, histologic definitions for endometriosis have remained stagnant for decades, with a lower than expected sensitivity, 12 particularly among younger women with endometriosis. 127 Superficial peritoneal endometriosis has been described as having a black (powder burn) or dark bluish appearance from the accumulation of blood pigments ( fig 2 ). 128 However, lesions can appear as white opacifications, red flame-like lesions, or yellow-brown patches in earlier, active stages of disease. 129 Ovarian endometriomas have a distinct morphology classically described as a “chocolate cysts,” containing old menstrual blood, necrotic fluid, and other poorly defined components that give their contents a dark brown appearance. Adhesions are often found in association with endometriomas and consist of fibrous scar tissue resulting from chronic inflammation. In many cases, endometriosis is present at the site of ovarian fixation. 130 Deep endometriosis appears as multifocal nodules and may infiltrate the surrounding viscera and peritoneal tissue. 131 Almost 40% of laparoscopies done for pelvic pain do not identify any pathology. 99 Clinicians should always consider other pelvic and non-pelvic visceral and somatic structures, as well as centrally mediated pain factors, that could be generating or contributing to the pain. 99

“Working diagnosis” of probable endometriosis

In women with a high suspicion of endometriosis, in whom imaging has not shown obvious pelvic pathology and a laparoscopy has not been done or is awaited, giving a “working diagnosis” of probable endometriosis and instigating early medical treatment without waiting for a more definitive diagnosis can be helpful. 13 114 132 133 This is an emerging concept for which some people use the terms “working” and “clinical” diagnosis interchangeably.

Delayed diagnosis

Endometriosis can occur at any age, with some patients reporting that pelvic pain symptoms arose at or soon after thelarche or menarche. Among women with endometriosis diagnosed in adulthood, nearly a fifth report that their symptoms began before age 20 and two thirds report onset before age 30. 5 The exact time of disease onset is unknown for endometriosis, as symptoms must emerge and be sufficiently life affecting to gain referral for definitive diagnosis. Furthermore, non-specific symptoms such as dysmenorrhea have often been treated with hormonal drugs without consideration of endometriosis, whereas the current recommendation is to be aware and consider a working diagnosis of probable endometriosis. Thus, varied non-specific symptomatology, normalization of pelvic pain, clinicians’ awareness of endometriosis, and economic and geographic access to care all contribute to a delay averaging seven years from symptom onset to surgical diagnosis. 1 5

Long term monitoring of endometriosis

Follow-up, including psychological support, should be considered in women with confirmed endometriosis, with renewed evaluation and a revised treatment plan if symptoms emerge, recur, or worsen over time. However, no evidence exists of benefit of regular long term monitoring (for example, imaging) for early detection of endometriotic lesion recurrence, complications, or malignant transformation, in the absence of complex ovarian masses or endometriosis with deep bowel effect. 134 135 Given growing evidence of risk of multisystem involving conditions ( fig 4 ), patient centered whole healthcare dictates that monitoring by general practitioners for emergence of signs and symptoms of mental health conditions, cardiovascular disease, immunologic and autoimmune disorders, gastrointestinal conditions, or multifocal pain conditions should be heightened and referral to a non-gynecologic specialist should be considered as needed.

Management of endometriosis associated pain

The growing recognition that endometriosis associated pain has a mixed pain phenotype (or occupies different points on a continuum) supports a personalized, multimodal, interdisciplinary treatment approach, 13 which might include surgical ablation/excision of lesions, analgesics, hormonal treatments, non-hormonal treatments including neuromodulators, and non-drug therapies (or a combination of the above). 1 The evidence supporting different surgical, pharmacologic, and non-pharmacologic approaches to treating endometriosis is examined below.

Surgical management of endometriosis associated pain

The most recent guidelines for endometriosis (for example, the National Institute for Health and Care Excellence (NICE), ESHRE) recommend surgery as a treatment option to reduce endometriosis associated pain. 13 114 However, only a limited number of RCTs have assessed pain outcomes after surgery (and most are small, offer little detail on endometriosis sub-phenotypes visualized at surgery, and have a follow-up period of less than 12 months). Furthermore, the authors of the most recent Cochrane review of surgery for endometriosis associated pain concluded that they were “uncertain of the effect of laparoscopic surgery on pain and quality of life” owing to the low quality of the available studies. 136 They included only two of the published RCTs (comparing surgical treatment of endometriosis with diagnostic laparoscopy alone) in their analysis of laparoscopic excision to improve pain and quality of life. 137 138 One trial of 16 participants experiencing pain associated with endometriosis assessed “overall pain” scores at 12 months (mean difference on 0-100 visual analog scale (VAS) 1.65, 95% confidence interval 1.11 to 2.19), and the other trial of 39 participants assessed quality of life at six months measured using the EuroQol-5D (mean difference 0.03, –0.12 to 0.18). The evidence of benefit for specific subtypes is discussed in more detail below.

Surgery for superficial peritoneal endometriosis

Little evidence shows that surgery to treat isolated superficial peritoneal endometriosis improves overall symptoms and quality of life. The uncertainty around surgical management of this subtype is compounded by the limited evidence to allow an informed selection of specific surgical modalities to remove the lesions (for example, laparoscopic ablation versus laparoscopic excision). 139 140

Surgery for ovarian endometriosis

To our knowledge, no RCTs have compared cystectomy versus no treatment in women with endometrioma and measured the effect on painful symptoms. Also, no published data indicate a threshold cyst size below which surgery may be safely withheld in the absence of suspicious features on imaging (surgery is the only means by which a tissue specimen can be obtained to rule out ovarian malignancy). Thus, surgical excision is generally considered the optimal treatment for ovarian endometriosis. Cystectomy, instead of drainage and coagulation, is the preferred surgical approach as it reduces recurrence of endometrioma and endometriosis associated pain. 141 Cystectomy should be chosen with caution for women who desire fertility, as a risk of fertility affecting diminished ovarian reserve exists, and a highly skilled conservative approach should be applied to minimize ovarian damage. 142

Surgery for deep endometriosis

Surgical treatment to completely excise deep disease is generally considered to be the treatment of choice. 143 144 Nevertheless, most of the studies that have reported improvements in quality of life following surgical excision of deep endometriosis (typically involving the bowel) have been done in small cohorts of women, usually from single centers, without a comparator arm, and this affects the precision and generalizability of the results. The largest multicenter prospective non-randomized study published to date reported the six, 12, and 24 month follow-up outcomes on nearly 5000 women undergoing laparoscopic excision of deep rectovaginal endometriosis. 143 This showed clinically and statistically significant reductions in premenstrual, menstrual, and non-cyclical pelvic pain, deep dyspareunia, dyschezia, low back pain, and bladder pain at 24 months (data from 524-560 participants for each symptom) with a corresponding improvement in quality of life (575 participants, median score on EuroQol-5D 76, 95% confidence interval 75 to 80). Although the results should be interpreted with caution, because data were missing for >70% of patients at 24 months, assigned score methods suggest that evidence of improvement remained statistically significant.

Hysterectomy for endometriosis

No RCTs on hysterectomy for the treatment of endometriosis associated pain have been done. Most published articles are retrospective case series, and only a few prospective studies have been reported. Hysterectomy (with or without oophorectomy) with removal of all visible endometriosis lesions should be reserved for women who no longer wish to conceive and who have not responded to more conservative management. Women with endometriosis should be informed that hysterectomy is not a “cure” for endometriosis and that it is best reserved for women with coexisting adenomyosis (which does occur inside the uterus) or for women with severe pain who have exhausted all other options to improve their symptoms. 145 Recent longitudinal studies have not found a benefit of bilateral oophorectomy for long term pain management. 145 146 Of note, BIPOC (black, indigenous, and people of color) women are more likely to have complications of hysterectomy, in part because they are more likely to undergo laparotomy rather than minimally invasive laparoscopy. 147 Women should be informed that hysterectomy is associated with long term morbidity, 148 including cardiovascular disease, 56 among those with and without surgically induced menopause. 149 150

Recurrence or progression of endometriosis after surgery

The reported recurrence rate of painful symptoms attributed to endometriosis is high, estimated as 21.5% at two years and 40-50% at five years. 146 151 However, although a purist’s definition of “endometriosis recurrence” calls for “second look” laparoscopy, it is most often diagnosed in the real world on the basis of recurrence of symptoms alone. In addition, no robust evidence exists to support an ordered progression of endometriotic lesions. In prospective studies of repeat surgeries, lesions progressed (in 29% of cases), regressed (in 42%), or were static (in 29%). 152 Surgical treatment of certain subtypes of endometriosis could also exacerbate painful symptoms. 153 154

Preoperative and postoperative hormone treatment

Preoperative hormone treatment has not been shown to improve the immediate outcome of surgery for pain, or reduce recurrence, in women with endometriosis. 155 A meta-analysis of 340 participants found that compared with surgery alone, postoperative hormone treatment of endometriosis reduced pelvic pain after 12 months (standardized mean difference on VAS −0.79, −1.02 to −0.56), but the evidence is very low quality. 155 Women with endometriosis who undergo hysterectomy with oophorectomy should be advised to start continuous combined hormone replacement therapy (HRT) for at least the first few years after surgery. 156 This may be changed later to estrogen alone, but this needs to be balanced with the theoretical risk of reactivation and malignant transformation of any residual endometriosis, which can occur many years later.

Pharmacologic management of endometriosis associated pain

Most women with suspected or known endometriosis use over-the-counter drugs, such as non-steroidal anti-inflammatory drugs (NSAIDs). However, the available evidence to support their use is scarce. The data on the benefit of NSAIDs are limited to one small RCT. 157 They can be useful as “breakthrough medication” in the management of a pain flare.

Hormonal treatments

Hormone treatments for endometriosis include combined contraceptives, progestogens, gonadotrophin releasing hormone (GnRH) agonists, GnRH antagonists, and aromatase inhibitors ( table 1 ). All of these hormone treatments (except the newer GnRH antagonists, which have not been so extensively studied) have been included in a multivariate network meta-analysis of the outcomes “menstrual pain” and “non-menstrual pelvic pain” (pain relief on VAS; total of 1680 participants). 114 All treatments led to a clinically significant reduction in pain on the VAS compared with placebo. The magnitude of this treatment effect is similar for all treatments, suggesting that little difference exists between them in their capacity to reduce pain. Furthermore, symptoms return after cessation of treatment and hormone treatments used to manage endometriosis all have side effects. In addition, although the contraceptive properties of the hormones may be welcome if the woman does not wish to become pregnant, they may be unwanted if fertility is desired.

Hormone treatments

• View inline

Non-hormonal treatments

Analgesic tricyclic antidepressants (for example, amitriptyline, nortriptyline), selective serotonin uptake inhibitors (for example, duloxetine) and anticonvulsants (for example, gabapentin and pregabalin) are sometimes used clinically in the treatment of endometriosis associated pain without a strong evidence base. 167 These “neuromodulatory drugs” differ from conventional analgesics, such as NSAIDs, in that they primarily affect the central nervous system’s modulation of pain rather than peripheral mediators of inflammation. However, in a recent RCT for the management of chronic pelvic pain (in the absence of endometriosis), gabapentin was not shown to be superior to placebo and was associated with dose limiting side effects. 168

Non-drug management of endometriosis associated pain

Pelvic physiotherapy.

An increasing number of women with endometriosis report anecdotal benefit from pelvic physiotherapy. Physiotherapists may support women with activity management (for example, exercises, pacing strategies, and goal setting) and/or use complementary approaches to manage their pelvic pain symptoms (for example, massage and trigger point release therapy). Establishing the independent benefit of standalone physiotherapy is difficult, because most studies have assessed it in combination with psychological and medical management. 169 Two small pilot studies assessed the outcome of manipulations and massage for relief of endometriosis associated pain specifically, but they included specific patient groups and need expansion and replication to support recommendations for care of endometriosis patients. 170 171

The most common psychologically based intervention for chronic pain is cognitive behavioral therapy (CBT). Most of the studies of CBT in women with endometriosis are of low quality, designed using different methods and based on different psychological frameworks (making separation of effects difficult). However, given that CBT has been evaluated across a spectrum of other chronic pain disorders and shown to be effective for developing pain coping strategies, 98 99 172 it should be integrated into individualized treatment plans when needed.

Dietary intervention

Diet has been postulated to affect symptoms of endometriosis. However, very few studies (all of limited quality) have evaluated the benefit of dietary interventions and their effect on endometriosis symptoms. Supplements, such as omega-3 polyunsaturated fatty acids (O-PUFAs), have been investigated as a way of reducing inflammation and pain in endometriosis. 173 174 In a recent review, decreased pain scores were observed in women with endometriosis after use of O-PUFAs, which were not seen in controls. 175 Clinicians should be aware that women with endometriosis have an increased risk of co-presenting with irritable bowel syndrome concomitant with endometriosis associated dyschezia. 44 Patients are not uncommonly referred for gastroenterology evaluation without consideration of potential endometriosis. 45

Treatment of endometriosis associated infertility

Hormonal/medical therapies.

No evidence exists of benefit of suppression of ovarian function in women with endometriosis associated infertility who wish to conceive. 176 Following surgery for endometriosis, women seeking pregnancy should not be treated with postoperative hormone suppression with the sole purpose of enhancing future pregnancy rates.

Surgery to increase chance of natural pregnancy

Moderate quality evidence from a Cochrane meta-analysis of three RCTs in a total of 528 participants shows that laparoscopic treatment (ablation or excision) of superficial peritoneal endometriosis increases viable intrauterine pregnancy rates compared with diagnostic laparoscopy only (odds ratio 1.89, 95% confidence interval 1.25 to 2.86). 136 We found no data on live birth rates, and the effect on ectopic pregnancy and miscarriage rates is unclear. No published RCTs have assessed fertility outcomes after surgery for ovarian or deep disease, and surgery is generally recommended only in the presence of painful symptoms. 13 Use of the Endometriosis Fertility Index to support decision making for the most appropriate option to achieve pregnancy after surgery (for example, women who may benefit from medically assisted reproduction) has been recently suggested. 13 68

Medically assisted reproduction

Low quality evidence shows that viable intrauterine pregnancy rates are increased in women with superficial peritoneal endometriosis if they undergo intrauterine insemination with ovarian stimulation, instead of expectant management or intrauterine insemination alone. In one RCT of 103 participants randomized either to ovarian stimulation with gonadotrophins and intrauterine insemination treatment or to expectant management, the live birth rate was 5.6 (95% confidence interval 1.18 to 17.4) times higher in the treated couples. 177 In women with ovarian or deep endometriosis, the benefit of ovarian stimulation with intrauterine insemination is unclear. No RCTs have evaluated the efficacy of assisted reproductive technology (ART) versus no intervention in women with endometriosis. Recommendations in guidelines suggesting that ART may be effective for endometriosis associated infertility have been based on meta-analyses of observational studies comparing the outcomes of ART in women with and without endometriosis. 13 178 179 Doing surgery before ART for infertility associated with superficial peritoneal endometriosis is not recommended, as the evidence suggesting benefit is based on a single retrospective study of low quality 180 (and is not supported by indirect evidence from multiple studies comparing outcomes in women with surgically treated endometriosis and those managed without surgery 179 ). Doing surgery for ovarian endometrioma before ART to improve live birth rates is also not recommended. Current evidence shows no benefit, and surgery is likely to have a negative effect on ovarian reserve. 181 182 In addition, no evidence shows that doing surgical excision of deep endometriosis before ART improves reproductive outcomes, and this should be reserved for women with concomitant painful symptoms.

Specialist endometriosis centers

Specialist centers were first formally proposed in 2006, 183 and this model of care has been successfully implemented in the UK and several other European countries such as Denmark, Germany, and France. 184 185 The role of specialist endometriosis centers should be to offer a coordinated, holistic, multidisciplinary, multimodal approach to women with complex symptoms of endometriosis that are experienced and evolve across the life course ( fig 5 ). Although relevant surgical expertise is important, the role of a center is not to focus solely on surgical treatment to eradicate lesions. Thus, a specialist center should offer an integrated service, including gynecologists, colorectal surgeons, urologists, endometriosis specialist nurses, pain medicine specialists, psychologists, physiotherapists, fertility specialists, and imaging experts.

Various national and international organizations have issued guidelines for the assessment and management of endometriosis. We reviewed and compared nine of these guidelines (including the recent 2022 update of the ESHRE guideline). 186 187 188 189 190 191 192 193 All of the guidelines recommend the combined oral contraceptive pill and progestogens for endometriosis associated pain, but they differ in the recommendations around “second line” medical treatments. All of the guidelines recommend laparoscopic surgery for the management of endometriosis associated pain, although some acknowledge the lack of evidence for surgery in the management of pain associated with superficial peritoneal endometriosis specifically. 13 114 No clear consensus exists regarding surgical treatment for endometriosis associated infertility, especially with regard to the management of an endometrioma before assisted reproduction.

Emerging diagnostic tools and treatments

Most endometriosis research studies to date have been underfunded and on a small scale, and have involved poorly defined populations of women and samples captured from those who receive a diagnosis well along in their endometriosis journey. However, real hope exists of a breakthrough in the development of a biomarker to diagnose endometriosis closer to emergence and earlier in its natural progression, and to predict response to treatment, owing to the establishment of globally harmonized endometriosis protocols for clinical data and human tissue collection. 105 106 107 The biomarker field will also hopefully benefit from new insights being gained from the study of serum microRNAs and metabolomics. 194 195 Preclinical studies of new non-hormonal medical treatments have offered insights by focusing on inflammation, pain, and metabolism as the platform for repurposing of drugs already approved for other conditions. 19 90 196 Increasing evidence also suggests that the “gut-brain axis” could be a novel therapeutic target for pain symptom relief in endometriosis. 197 Microbiomes likely play a role in the gut-brain axis, are associated with the spectrum of symptoms associated with endometriosis, and are an exciting putative therapeutic target. Lastly, although randomized evaluations of surgical interventions for endometriosis have been rare (and some interventions have been adopted without rigorous evaluation), we are witnessing important collaboration between research and surgical communities to conduct large scale, appropriate, and well designed trials (for example, PRE-EMPT ( https://www.birmingham.ac.uk/research/bctu/trials/womens/pre-empt/index.aspx ), REGAL ( https://w3.abdn.ac.uk/hsru/REGAL/Public/Public/index.cshtml ), ESPriT2 ( https://www.ed.ac.uk/centre-reproductive-health/esprit2 ), and DIAMOND ( https://w3.abdn.ac.uk/hsru/DIAMOND/Public/Public/index.cshtml )). Surgical trials are difficult to undertake successfully and pose practical and methodological challenges. However, the inherent value of a well conducted RCT to predict the outcomes and/or success rates of surgical treatments for endometriosis should not be overlooked.

Endometriosis is a prevalent, often life affecting condition that in most women emerges during adolescence and can evolve to include symptoms and conditions encompassing multiple systems. Endometriosis demands to be known, considered, and tackled by all practitioners—general and specialist—who treat female patients at all stages across the life course. Patient centered whole healthcare requires a dialog between a woman and her healthcare practitioners to monitor symptom remediation, persistence, or recurrence and to prioritize the focus of care—for example, fatigue remediation when sports participation is paramount, fertility when family building is desired, a revision of medical treatment during perimenopause, or early response to signs of cardiovascular changes. Stigma around menstrual health and chronic pain remain all too ubiquitous barriers to high quality healthcare. Awareness in the general public and among healthcare providers is essential.

Once their symptoms are acknowledged and treated, most patients with endometriosis do well. However, despite overcoming diagnostic delays and access to state of the art treatment, some experience persistence or progression of symptoms. Critical next steps for discovery include defining sub-phenotypes of endometriosis that classify patients into groups that are predictive of prognosis and the natural course of the condition and indicate selection of treatments most likely to be successful to restore high quality of life. We must also answer foundational questions that remain about the causes and natural progression of endometriosis that need expanded funding and attraction of multidisciplinary scientists from all areas of population and bench science. Recommendations to permit a “working diagnosis” of probable endometriosis are having an effect on patient centered care and faster symptom remediation. Through the work of endometriosis associations, non-governmental organizations, and the endometriosis community across the globe, awareness of endometriosis has increased in recent years, along with some increases in funding. We are early on the necessary trajectory, but the journey is gaining speed.

Questions for future research

What causes endometriosis?

Can a non-invasive screening tool be developed to aid the diagnosis of endometriosis?

What are the most effective ways of maximizing and/or maintaining fertility in women with confirmed or suspected endometriosis?

What are the most effective ways of managing the emotional, psychological, and/or fatigue related impact of living with endometriosis?

Can we predict the outcomes and/or success rates for surgical or medical treatments for endometriosis?

What are the most effective non-surgical ways of managing endometriosis related pain and/or symptoms?

Adapted from the James Lind Alliance “Top ten research priorities for endometriosis in the UK and Ireland” 198

Patient involvement

We consulted Emma Cox, chief executive of Endometriosis UK, a nationally recognized representative and voice of patients with endometriosis, in the development of this review, and she commented on the draft and final manuscript. No patients were involved directly in the preparation of this article.

Acknowledgments

In addition to invaluable insight provided by Emma Cox, we thank Naoko Sasamoto and Marzieh Ghiasi for early design of figures 1 and 4, which were further adapted by SAM for this review; Kevin Kuan for designing figure 3 in BioRender; and Dan Martin for contributing image 1 to figure 2.

Series explanation: State of the Art Reviews are commissioned on the basis of their relevance to academics and specialists in the US and internationally. For this reason they are written predominantly by US authors

Contributors: AWH and SAM contributed equally to the planning, analysis, and writing of the article. AWH is the guarantor.

Funding: AWH is supported by an MRC Centre Grant (MRC G1002033) and an NIHR Project Grant (NIHR129801).

Competing interests: We have read and understood BMJ policy on declaration of interests and declare the following interests: AWH’s institution (University of Edinburgh) has received payment for consultancy and grant funding from Roche Diagnostics to assist in the early development of a possible blood diagnostic biomarker for endometriosis. AWH has received grant funding from the MRC and NIHR for endometriosis research; he is a board member of the World Endometriosis Society and Society for Endometriosis and Uterine Disorders, is co-editor in chief of Reproduction and Fertility , has been a member of the NICE and ESHRE Endometriosis Guideline Groups, and is a trustee and medical adviser to Endometriosis UK. SAM has received payment for consultancy and grant funding from AbbVie, LLC, for population based research unrelated to product development and has received grant funding from the US National Institutes of Health, US Department of Defense, and the Marriott Family Foundations for endometriosis research. SAM is a board member of the World Endometriosis Society, World Endometriosis Research Foundation, American Society for Reproductive Medicine Endometriosis Special Interest Group, and the European Society for Human Reproduction and Embryology Special Interest Group on Endometriosis and Endometrial Disorders; a member of the Interdisciplinary Network on Female Pelvic Health of the Society for Women’s Health Research; and is a statistical advisory board member for Human Reproduction and field chief editor for Frontiers in Reproductive Health .

Provenance and peer review: Commissioned; externally peer reviewed.

• Zondervan KT ,
• Becker CM ,
• Prescott J ,
• Farland LV ,
• Tobias DK ,
• Soliman AM ,
• Simoens S ,
• Dunselman G ,
• Dirksen C ,
• Nnoaham KE ,
• Hummelshoj L ,
• Webster P ,
• World Endometriosis Research Foundation Global Study of Women’s Health consortium
• Stratton P ,
• Cleary SD ,
• Ballweg ML ,
• Missmer SA ,
• Agarwal SK ,
• Kulkarni MT ,
• Shafrir AL ,
• Taylor HS ,
• Adamson GD ,
• Diamond MP ,
• Heikinheimo O ,
• ESHRE Endometriosis Guideline Group
• DiVasta AD ,
• Vitonis AF ,
• Laufer MR ,
• Ballard K ,
• Tomassetti C ,
• Johnson NP ,
• Petrozza J ,
• International Working Group of AAGL, ESGE, ESHRE and WES
• Saunders PTK ,
• Andres MP ,
• Arcoverde FVL ,
• Souza CCC ,
• Fernandes LFC ,
• Halvorson LM
• Isaacson K ,
• Halvorson LM ,
• Giudice LC ,
• Vannuccini S ,
• Petraglia F ,
• Bourdon M ,
• Santulli P ,
• Jeljeli M ,
• Saunders PTK
• Williams C ,
• Bedaiwy MA ,
• Counsellor VS
• Eskenazi B ,
• Coloma JL ,
• Martínez-Zamora MA ,
• Collado A ,
• Larrosa Pardo F ,
• Bondesson E ,
• Schelin MEC ,
• Palmor MC ,
• Fourquet J ,
• Miller JA ,
• Shigesi N ,
• Kvaskoff M ,
• Kirtley S ,
• Harris HR ,
• Korkes KMN ,
• Costenbader KH ,
• Kennedy SH ,
• Jenkinson C ,
• World Endometriosis Research Foundation Women’s Health Symptom Survey Consortium
• Rodríguez MA ,
• Buchwald DS ,
• National Institute of Diabetes and Digestive and Kidney Diseases Working Group on Urological Chronic Pelvic Pain
• Tirlapur SA ,
• Chaliha C ,
• Chiaffarino F ,
• Cipriani S ,
• Zimmerman LA ,
• Fadayomi AB ,
• Morotti M ,
• Pogatzki-Zahn EM ,
• Liedgens H ,
• IMI-PainCare PROMPT consensus panel
• Nunez-Badinez P ,
• Laux-Biehlmann A ,
• Gallagher CS ,
• Mäkinen N ,
• 23andMe Research Team
• Mahamat-Saleh Y ,
• Thombre Kulkarni M ,
• Shafrir A ,
• Degnan WJ 3rd . ,
• Rich-Edwards J ,
• Spiegelman D ,
• Forman JP ,
• Vincent K ,
• Taylor RN ,
• Symons LK ,
• Miller JE ,
• Rahmioglu N ,
• Morris AP ,
• WERF EPHect Working Group
• Whitaker LHR ,
• Vermeulen N ,
• Einarsson JI ,
• International working group of AAGL, ESGE, ESHRE and WES
• ↵ Revised American Society for Reproductive Medicine classification of endometriosis: 1996 . Fertil Steril 1997 ; 67 : 817 - 21 . doi: 10.1016/S0015-0282(97)81391-X   pmid: 9130884 OpenUrl CrossRef PubMed Web of Science
• Tuttlies F ,
• Keckstein J ,
• Saridogan E ,
• Ulrich UA ,
• Schliep KC ,
• Mumford SL ,
• Peterson CM ,
• Shamiyeh A ,
• World Endometriosis Society Sao Paulo Consortium
• Borrelli GM ,
• Maheux-Lacroix S ,
• Nesbitt-Hawes E ,
• Janssen EB ,
• Rijkers AC ,
• Hoppenbrouwers K ,
• Meuleman C ,
• D’Hooghe TM
• Christ JP ,
• Schulze-Rath R ,
• Grafton J ,
• Treloar SA ,
• O’Connor DT ,
• O’Connor VM ,
• Pettersson HJ ,
• Svedberg P ,
• Nyholt DR ,
• ANZGene Consortium ,
• International Endogene Consortium ,
• Genetic and Environmental Risk for Alzheimer’s disease Consortium
• Sapkota Y ,
• Steinthorsdottir V ,
• iPSYCH-SSI-Broad Group
• Hammond MG ,
• Cousins FL ,
• Figueira PG ,
• Critchley HOD ,
• Babayev E ,
• Gajbhiye R ,
• McKinnon B ,
• Mortlock S ,
• Mueller M ,
• Montgomery G
• Saunders PT ,
• Greaves E ,
• Esnal-Zufiurre A ,
• Mechsner S ,
• Saunders PT
• As-Sanie S ,
• Harris RE ,
• Napadow V ,
• Coccia ME ,
• Rizzello F ,
• Palagiano A ,
• Scarselli G
• Sutton CJ ,
• Whitelaw N ,
• Khachikyan I ,
• Carrillo J ,
• Di Tucci C ,
• Di Feliciantonio M ,
• Senapati S ,
• Sammel MD ,
• Barnhart KT
• Carvalho LFP ,
• Fassbender A ,
• Buck Louis GM
• Gallagher JS ,
• Angioni S ,
• Gemmell LC ,
• Webster KE ,
• VanBuren WM ,
• Kuznetsov L ,
• Dworzynski K ,
• Overton C ,
• Guideline Committee
• Ballard KD ,
• Seaman HE ,
• de Vries CS ,
• Bonsignore L ,
• Samuels S ,
• Vercellini P
• Rouzier R ,
• Thomassin-Naggara I ,
• Nisenblat V ,
• Bossuyt PM ,
• Farquhar C ,
• Johnson N ,
• Moura APC ,
• Ribeiro HSAA ,
• Bernardo WM ,
• Buck Louis GM ,
• Hediger ML ,
• ENDO Study Working Group
• Guerriero S ,
• Condous G ,
• van den Bosch T ,
• Leonardi M ,
• Mestdagh W ,
• Stamatopoulos N ,
• Watkins JC ,
• Mettler L ,
• Schollmeyer T ,
• Lehmann-Willenbrock E ,
• Jansen RP ,
• Koninckx PR ,
• Adamyan L ,
• Wattiez A ,
• Barraclough K ,
• Chapron C ,
• Andreotti RF ,
• Vercellini P ,
• Sergenti G ,
• Frattaruolo MP ,
• Beebeejaun Y ,
• Bosteels J ,
• Jarrell J ,
• Mohindra R ,
• Taenzer P ,
• Daniels J ,
• DeSarno M ,
• Findley J ,
• Maouris P ,
• Shaltout MF ,
• Elsheikhah A ,
• BSGE Endometriosis Centres
• Bendifallah S ,
• Sandström A ,
• Johansson M ,
• Bäckström T ,
• Shakiba K ,
• McGill KM ,
• Orlando MS ,
• Luna Russo MA ,
• Richards EG ,
• Stewart EA ,
• Laughlin-Tommaso SK ,
• Weaver AL ,
• Hans Evers JL
• Schrepf AD ,
• Zakhari A ,
• Delpero E ,
• McKeown S ,
• Tomlinson G ,
• Choudhry AJ ,
• ↵ British Menopause Society. Tools for Clinicians: induced menopause in women with endometriosis. 2019. https://thebms.org.uk/publications/tools-for-clinicians/ .
• Kauppila A ,
• di Tucci C ,
• Achilli C ,
• Benedetti Panici P
• Kettner LO ,
• Lessey BA ,
• Tanimoto M ,
• Kusumoto T ,
• Arjona Ferreira JC ,
• Hewitt CA ,
• GaPP2 collaborative
• Nordling J ,
• Jaszczak P ,
• Deboute O ,
• Zacharopoulou C ,
• Valiani M ,
• Ghasemi N ,
• Bahadoran P ,
• Williams ACC ,
• Eccleston C
• Abokhrais IM ,
• Denison FC ,
• Nodler JL ,
• Collins JJ ,
• Fedorkow DM ,
• Vandekerckhove P
• Tummon IS ,
• Martin JS ,
• Gallos ID ,
• Coomarasamy A
• Opøien HK ,
• Fedorcsak P ,
• Nickkho-Amiry M ,
• Majumder K ,
• Edi-O’sagie E ,
• D’Hooghe T ,
• Hummelshoj L
• van Hanegem N ,
• van Kesteren P ,
• Kalaitzopoulos DR ,
• Samartzis N ,
• Kolovos GN ,
• Dunselman GA ,
• European Society of Human Reproduction and Embryology
• Collinet P ,
• Revel-Delhom C ,
• Buchweitz O ,
• German and Austrian Societies for Obstetrics and Gynecology
• Leyland N ,
• Laberge P ,
• Practice Committee of the American Society for Reproductive Medicine
• World Endometriosis Society Montpellier Consortium
• Moustafa S ,
• Mamillapalli R ,
• Nematian S ,
• Koscielniak M ,
• Williams L ,
• Salliss ME ,
• Mahnert ND ,
• Herbst-Kralovetz MM
• Endometriosis Priority Setting Partnership Steering Group (appendix)

Join a Study Grants & Funding Positions Available Connect with Us

Join a Study Grants & Funding Positions Available Connect

• News & Events

The Science of Endometriosis–Endometriosis 101: Clinical Studies

Recorded on June 11, 2021, MIT’s Professor Linda Griffith and Michigan State University’s Dr. Stacey Missmer discussed endometriosis clinical studies and answered questions from the webinar attendees, including, “How can patients contribute to a clinical study or trial?” and “Why don’t we know more about endometriosis?”

About   The Science of Endometriosis

Hosted by scientists, clinicians, and other experts, The Science of Endometriosis is a virtual series that brings together patients, families, researchers, healthcare providers, communities, business leaders, and academic leaders to examine the health impact of endometriosis and discuss bold ideas and actions to achieve better diagnoses and treatments for this common life impacting disease.

Join our mailing list for resources on these topics and to learn more about recent and future events.

Linda Griffith  (BS Georgia Tech, PhD UC Berkeley, Chemical Engineering) is MIT’s School of Engineering Teaching Innovation Professor of Biological and Mechanical Engineering and MacVicar Fellow, where she co-founded and directs the Center for Gynepathology Research. Griffith has endometriosis and has had multiple surgeries for it. She and her colleagues are doing groundbreaking research into this disease.

Griffith led the development of MIT’s Biological Engineering SB degree program, which was approved in 2005 as the university’s first new undergraduate major in 39 years. She has pioneered approaches in tissue engineering and recently led one of two major DARPA-supported “body-on-a-chip” programs, resulting in the first platform to culture 10 different human mini-organ systems interacting continuously for a month.

Griffith leads the field of “Physiomimetics,” integrating these platform technologies with systems biology and systems immunology to humanize drug development for the most challenging chronic inflammatory diseases, including endometriosis and adenomyosis, through collaboration with industry partners in Pharma and Biotech around the world. She has over 200 peer-reviewed scientific publications and holds over a dozen patents and is a member of the National Academy of Engineering, the recipient of a MacArthur Foundation Fellowship, Radcliffe Fellowship, the National Academy of Engineering’s 2021 Bernard M. Gordon Prize for Innovation in Engineering and Technology Education, and several awards from professional societies.

Stacey Missmer  (BA Lehigh University, Master (M.Sc.) and Doctor of Science (Sc.D.) Harvard University, Epidemiology) is a Professor of Obstetrics, Gynecology, and Reproductive Biology at Michigan State University; Adjunct Professor in Epidemiology at Harvard TH Chan School of Public Health; and Lecturer in Pediatrics at Harvard Medical School.

As a teen and young woman, Dr. Missmer struggled with chronic pelvic pain. Her journey as an endometriosis-focused scientist began with her doctoral dissertation in 1998 within the Nurses’ Health Study research group at Channing Laboratory. Author of 300 peer-reviewed scientific publications, much of her research has focused on identifying factors that affect the risk for and consequences of endometriosis. In 2012, Dr. Missmer co-founded the Boston Center for Endometriosis and serves as the Scientific Director. That same year she launched, with co-PI Dr. Krina Zondervan, the World Endometriosis Research Foundation Endometriosis Phenome and Biobanking Harmonization Project (WERF EPHect), which provides standardized tools for endometriosis-focused data and biologic sample collection.

Dr. Missmer is President-Elect of the World Endometriosis Society, Immediate Past Chair of the American Society for Reproductive Medicine Endometriosis Special Interest Group, and a WERF Trustee.

Related Posts

• Copy/Paste Link Link Copied

Find a Study on Endometriosis

Select one of the following links to get ClinicalTrials.gov search results for studies on endometriosis:

• All NICHD clinical trials on endometriosis
• All ClinicalTrials.gov trials on endometriosis

Now Recruiting

NOTE-2 Study The NOTE-2 (Novel Treatments for Endometriosis) Study is a 6-month clinical trial currently being offered. This research study is investigating whether an existing non-hormonal medication is effective for controlling pain and symptoms of endometriosis. We will be comparing this study medication to a placebo pill.

Dietary Intervention to Reduce Pain in People with Endometriosis Volunteers are needed for a dietary study to reduce pain in people with endometriosis. You may be eligible if you are ages 18-45 years and have endometriosis.

Women’s Health Study: From Adolescence to Adulthood (A2A) A2A is a longitudinal study exploring women’s health conditions over a lifespan.

Completed Studies

Endometriosis Brain Imaging Study The Endometriosis Brain Imaging Study seeks to understand why some people with endometriosis have pain. Women 12-44 years old may be eligible for the study.

NOTE Pilot Study The NOTE Pilot Study was a 6 month clinical trial comparing two medications for the treatment of endometriosis pain.

SAGE Trial The SAGE Trial was a 6 month trial exploring the effects of nutrition on the development and severity of the symptoms of endometriosis. Research results were published in the American Journal of Clinical Nutrition.

Progression Study The Progression Study was a substudy of the Women’s Health Study: From Adolescence to Adulthood designed to learn more about endometriosis. Participants were asked to provide a saliva and blood sample at pre-op (before surgery), post-op (6 weeks after surgery), and 1 year after surgery.

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings

Preview improvements coming to the PMC website in October 2024. Learn More or Try it out now .

• Advanced Search
• Journal List
• Front Glob Womens Health

Endometriosis Is Undervalued: A Call to Action

Katherine ellis.

1 Department of Mechanical Engineering, University of Canterbury, Christchurch, New Zealand

Deborah Munro

Jennifer clarke.

2 Faculty of Health, University of Canterbury, Christchurch, New Zealand

Associated Data

The original contributions presented in the study are included in the article; further inquiries can be directed to the corresponding author.

Endometriosis is an inflammatory chronic pain condition caused by uterine tissue growing outside of the uterus that afflicts at least 11% of women (and people assigned female at birth) worldwide. This condition results in a substantial burden to these women, and society at large. Although endometriosis was first identified over 160 years ago, substantial knowledge gaps remain, including confirmation of the disease's etiology. Research funding for endometriosis is limited, with funding from bodies like the National Institutes of Health (NIH) constituting only 0.038% of the 2022 health budget—for a condition that affects 6.5 million women in the US alone and over 190 million worldwide. A major issue is that diagnosis of endometriosis is frequently delayed because surgery is required to histologically confirm the diagnosis. This delay increases symptom intensity, the risk of central and peripheral sensitization and the costs of the disease for the patient and their nation. Current conservative treatments of presumed endometriosis are pain management and birth control. Both of these methods are flawed and can be entirely ineffective for the reduction of patient suffering or improving ability to work, and neither addresses the severe infertility issues or higher risk of certain cancers. Endometriosis research deserves the funding and attention that befits a disease with its substantial prevalence, effects, and economic costs. This funding could improve patient outcomes by introducing less invasive and more timely methods for diagnosis and treatment, including options such as novel biomarkers, nanomedicine, and microbiome alterations.

Introduction

Endometriosis is a chronic inflammatory disease ( 1 ) that causes significant morbidity ( 2 ), and affects 10–15% of women of reproductive age globally ( 3 – 5 ). Conservatively, 1 in 9 women of reproductive age has endometriosis in the United States (US) ( 6 ) and Australia ( 7 ). Endometriosis causes tissue from the uterus to migrate and implant in other regions of the body ( 8 , 9 ). This tissue interacts with the body's endocrine, musculoskeletal, vascular, reproductive, and nervous systems ( 10 ) causing numerous painful symptoms and physiological changes. There are three key types of endometriosis: superficial peritoneal, ovarian, and deep infiltrating ( 11 ). While peritoneal is the predominant presentation of the disease, ovarian affects 17–44% of endometriosis patients ( 12 ) and is characterized by the development of ovarian endometriomas, cystic lesions filled with dark endometrial fluid ( 13 ). Deep infiltrating endometriosis affects ~20% of endometriosis patients ( 14 ) and is considered the most severe form ( 15 ). Each endometriosis subtype is thought to have a different pathogenesis ( 16 ), but no etiology is confirmed ( 17 ) that explains all disease manifestations ( 18 ).

Symptom Burden

Misplaced endometriotic tissue causes a wide range of symptoms, including chronic pelvic pain, dysmenorrhea (menstrual pain), dyspareunia (painful sex), dysuria (painful urination), dyschezia (painful defecation) ( 19 ), metrorrhagia (mid-cycle bleeding), diarrhea, constipation, infertility ( 20 ), and myofascial pain, among others ( 1 ). Furthermore, the gastrointestinal symptoms of endometriosis patients are more severe than those of controls ( 21 ), which often results in both coexistence and misdiagnosis of irritable bowel syndrome ( 22 ). As the disease progresses, patients risk developing adhesions, fibrous scar tissue bands that can abnormally bind pelvic and abdominal organs ( 9 ). Endometriosis is the most frequent cause of adhesions in women and common areas for endometriosis adhesions include the anterior abdominal wall, bladder, and uterus ( 23 ). Adhesions can cause anatomical distortion, which can hinder fertility, cause rectal constriction, and be a cause of dyspareunia. In a 2019 study, the presence of endometriosis-associated adhesions was shown to significantly negatively impact quality of life ( 23 ).

The cumulative effect of these chronic pain symptoms is a substantial burden on sufferers ( 20 ) and 70% of patients live with unresolved pain ( 2 ), with impacts to all aspects of their quality of life ( 24 ). Research shows that endometriosis patients also have significantly higher rates of co-morbidities than control populations ( 25 ). The symptoms of endometriosis, particularly those associated with pain, increase the rates of chronic stress, anxiety, depression and decreased quality of life among endometriosis patients compared with those without the disease ( 26 ).

There is a well-established delay from symptom onset to diagnosis of 4–11 years for endometriosis patients ( 1 ). There are many reasons for this delay, including the lack of a unique symptom profile ( 27 ), the variety of symptoms ( 28 ) and large waitlists for the laparoscopies used to diagnose endometriosis ( 2 ). Many patients find it necessary to “doctor shop” to find a medical practitioner who will support their efforts to obtain an endometriosis diagnosis. In a 2004 study, 47% of endometriosis patients had seen at least five doctors before getting an endometriosis diagnosis or referral ( 29 ). This may be partially explained by the results of a 2021 French study, where 25% of general practitioners did not think they knew enough about endometriosis for their clinical practice ( 30 ). In a 2012 study of 173 endometriosis patients in Austria and Germany, 74.3% had experienced a misdiagnosis. These misdiagnoses included intolerances, appendicitis, irritable bowel syndrome, and pelvic inflammatory disease ( 31 ).

In addition to painful symptoms, patients can be subject to central and peripheral sensitization ( 10 ). Central sensitization is the abnormal processing of sensory signals ( 32 ) that results in exaggerated experiences of painful and non-painful stimuli ( 10 ) through enhanced pelvic nociception. Peripheral sensitization lowers the body's threshold for nociceptor activation with repetitive and prolonged stimulation, as occurs in endometriosis ( 10 ). The combined effect of these phenomena is that over time non-painful stimuli can produce incredibly painful signals in sensitized patients.

Women with chronic pelvic pain, with or without a confirmed diagnosis, show significantly lower pain tolerances than controls ( 33 ). The severity of the decrease in pain tolerance corresponds to the duration of symptoms ( 33 ) supporting the theory that delayed diagnosis increases patient sensitization. An Australian study found endometriosis patients have significantly higher functional pain disability (pain interference with daily activities like sleep, relationships and work) than women without endometriosis ( 34 ). Furthermore, women have higher pain sensitivity than men ( 35 , 36 ) as a result of complex interactions in women of anatomical, hormonal, physiological, and psychological factors ( 37 ).

Cancer Associations

Endometriosis is a non-neoplastic invasive disease ( 38 ), although there is evidence to suggest a positive association between endometriosis and ovarian cancer ( 39 ). There is molecular evidence to suggest endometriotic lesions can undergo a transformation to clear cell and endometrioid ovarian cancers ( 40 ). This connection is controversial, and like many aspects of endometriosis, requires much more study to fully outline the potential mechanisms involved. The indication is that endometriosis increases ovarian cancer risk ( 19 ) from 1.3% in the general female population to 1.8% of endometriosis patients ( 41 ).

Infertility

In addition to the extensive pain symptoms endometriosis patients experience, endometriosis patients have a high prevalence of infertility and sub-fertility among their cohort. Half of endometriosis patients suffer from fertility issues ( 42 ), and up to half of women with unexplained infertility or sub-fertility are subsequently found to have endometriosis ( 43 , 44 ). The high rates of endometriosis interfering with fertility may relate to factors including anatomical distortions ( 45 ), diminished ovarian reserve, chronic inflammation and compromised endometrial receptivity ( 42 ).

Lack of Funding

Endometriosis is a condition that impacts not only patients, but their families, jobs, societies, and countries. The authors believe the present issues with diagnosing, treating and funding endometriosis result from many years of misunderstanding and ignoring important female health topics. Improving funding for endometriosis research could improve the understanding of the condition, eliminate knowledge gaps, reduce time to diagnosis, expand available treatment options, improve pain management and place a long-overdue emphasis on predominantly female experiences of illness.

The National Institutes of Health (NIH) is the largest source of biomedical research funding globally, allocating $41.7 billion USD annually ( 46 ). In 2022, the expected funding allocation for endometriosis is $16 million ( 47 ), 0.038% of the budget. Since the conservative estimate is that endometriosis affects 11% of US women in their lifetime, only $2.00 per patient per year is allocated. As a comparison, 12% of US women are expected to suffer from diabetes in their lifetime ( 48 ). If it is assumed that half of the allocated diabetes research budget was for female sufferers, there is a funding allocation of $31.30 per woman, over 1,500% more than for endometriosis.

Crohn's disease, like endometriosis, is a chronic inflammatory condition ( 49 ). Crohn's disease affects the digestive tract lining, resulting in abdominal pain, weight loss, diarrhea, and fatigue ( 50 ). There are over 690,000 people with Crohn's disease in the US, or 0.21% of the population ( 51 ). In 2022, Crohn's disease research will receive $90 million in funding, $130.07 per patient, over 65 times more per patient than for endometriosis. This comparison is not to suggest Crohn's disease is overfunded, but that endometriosis is seriously underfunded.

Economic Burden of Endometriosis

The burden of endometriosis on individual patients is substantial ( 20 ) both before and after diagnosis ( 52 ). The impact of ongoing pain can cause some patients to lose their jobs or their partners ( 53 ). Additionally, the financial burden is significant. Endometriosis patients have significantly higher healthcare resource utilization, and direct and indirect healthcare costs than controls. Endometriosis patients in the US spend $26,305 USD more than controls on healthcare expenses in the 5 years before and after diagnosis ( 52 ). In the year after diagnosis patients with endometriosis spend on average 3.5 times the amount on healthcare than controls do ( 25 ). The direct costs of endometriosis include in and outpatient treatment, surgery, and prescription costs, which in the US average $12,118 per patient, per year ( 54 ). Indirect costs, including days of work lost and reduced quality of work, were almost $16,000 per patient per year ( 54 ). In a study across ten countries lost productivity costs were generally double those of healthcare costs ( 55 ) as the average patient loses 6.4 h of work a week to presenteeism (reduced effectiveness while working) ( 56 ). Endometriosis patients begin to suffer from their condition at a young age, during a very productive period of their lives. The additive effects of fatigue, productivity loss, and time removed from the workforce, schooling and training create an immense barrier to patients being able to effectively progress in life, take up career opportunities, and in their capacity to save their earnings.

The total US endometriosis economic burden is estimated to be as high as $78–119 billion annually ( 54 , 57 ). In Australia, the annual cost of endometriosis was estimated to be $16,970–20,898 per woman, per year, with 75–84% of the total due to productivity losses ( 58 ). Delays until endometriosis diagnosis increase not only the number of pre-diagnosis endometriosis symptoms but also emergency visits, hospitalizations, and overall healthcare costs ( 59 ). Compared to short delays of less than a year, long delays of 3–5 years from first symptom presentation to diagnosis, increased the cost of healthcare in the 5 years prior to diagnosis by $12,971–34,460 ( 59 ).

Lost workdays are also higher among endometriosis patients than control populations ( 25 ). In Australia, where the annual economic burden of endometriosis is estimated to be $6.5 ( 58 ) to $7.4 billion ( 60 ), endometriosis patients used on average 60% of their sick leave to treat their chronic pain ( 60 ). In a 2022 study, 65% of an Australian cohort of endometriosis patients used unpaid leave to manage their endometriosis symptoms, 64% felt judged in the workplace for their symptoms, and one in seven reported being fired as a result of their condition ( 61 ).

Furthermore, research shows there are immense productivity losses due to endometriosis for women in the workforce, even while at work. Fatigue is more common among endometriosis patients, than in control populations ( 62 ). In a 2021 Canadian study on fatigue, endometriosis patients reported substantial impairments to their work productivity with 46.5% overall work impairment due to endometriosis-related symptoms ( 63 ). These findings were like a 2013 Danish study that found that patients with endometriosis had significantly more pain than controls, were in more pain when using their sick days and used more sick days ( 64 ). This study also found that many women were embarrassed by their symptoms, felt obligated to use their sick days and often felt unable or too tired to do a satisfying job ( 64 ).

In the US, the diabetes economic burden is $327 billion ( 65 ), and with 37.3 million Americans with diabetes ( 48 ), that accounts for $8,767 of burden per patient. By comparison, the estimated economic burden of endometriosis in the US would account for $9,754–14,881 per patient, 11–70% higher than for diabetes. Thus, it is evident to the authors there is an immense financial burden not only on endometriosis patients but on nations with patients who then require high levels of healthcare utilization. These patients frequently cannot participate in their workplaces and economies to the degree they wish because of symptoms, incurring a further cost to patients and society. If endometriosis was funded by the NIH at the same level as diabetes with respect to the annual economic burden, endometriosis funding would need to increase to $298.8–455.3 million, rather than the current $16 million.

The Present Options

Low research funding for endometriosis research means knowledge gaps are not being filled, making the development of effective diagnosis and treatment options more complicated, more time consuming, and less enticing for researchers. As a consequence, presently available options to treat endometriosis are severely limited. There are also high recurrence rates of symptoms and disease for current interventions ( 66 ). Recurrence of symptoms for non-surgical therapies, such as birth control and pain management, are rapid ( 18 ), because non-surgical treatments reduce or repress symptoms, but do not cure the disease. Furthermore, these methods are entirely inefficacious for endometriosis-associated fertility issues ( 19 ). Effective, non-invasive, non-hormonal treatments are required but are not currently available to the over 190 million global endometriosis patients ( 67 ).

Birth Control

Birth control is a standard endometriosis treatment ( 68 ). Endometriosis birth control methods include intrauterine progesterone devices, progestin injections and combined hormone pills ( 69 ). Combined treatments increase the risk of thromboembolism, nausea and breast tenderness. Progestin injections can cause weight gain, decreased bone density, worsened acne, and depression ( 69 ). Birth control is also a limited treatment for endometriosis, as many women cannot use birth control because the side effects are too severe or because of a desire to get pregnant.

Pain Management

Pain is the most common symptom of endometriosis ( 70 ). However, endometriosis pain management is complex. There is inconclusive evidence that non-steroidal anti-inflammatory drugs provide greater relief than placebos ( 71 ). Opioids are not a recommended treatment for endometriosis ( 72 ); however, in a cohort of 113,506 endometriosis patients in the US, 89% were utilizing opioids to manage their pain ( 25 ). Chronic opioid use can significantly increase healthcare costs for endometriosis patients compared to non-chronic users ( 73 ). Long-term opioid use for non-cancerous chronic pain, such as endometriosis, is controversial and results in an absolute adverse event rate of 78% ( 74 ). The high use of opioids among this cohort is indicative of the intensity of the pain experienced, but this approach can lead to addiction and side effects, including constipation, nausea, confusion and drowsiness ( 75 ). The required dosage to manage pain also increases with chronic use as the body becomes habituated to it ( 76 ).

Laparoscopic surgery is considered the “gold-standard” for diagnosing and treating endometriosis ( 18 ) and is the only method available to “confirm” endometriosis histologically ( 77 ) which provides a clear and unambiguous diagnosis for patients that is often essential for practitioners to provide the best treatment plan. According to one study, 42% of patients have undergone at least three surgeries ( 2 ). Surgery is thus an impermanent solution for many patients, with recurrence of both symptoms and lesions ( 19 ) expected for 40–50% of patients within 5 years ( 78 ), and this repeated intervention can exacerbate pain and fertility issues ( 79 ). Furthermore, surgery is a trauma to the body that activates adrenergic signaling, suppresses cell-mediated immunity and promotes angiogenesis ( 80 ). In mice with induced endometriosis, subsequent surgery increased lesion weight and microvessel density ( 80 ), which is counteractive to the intent of surgery for endometriosis.

Evolving Possibilities

Earliest descriptions of endometriosis date back to 1860 ( 81 ) and 1920 ( 82 ). However, we still do not understand its etiology ( 70 ), the biology and function of both healthy female and endometriotic peritoneum, or the actions of endometrial stem cells ( 83 ). A substantial amount of knowledge still needs to be collected, collated, and applied to patient care. The lack of progress despite the relatively high volume of papers published about endometriosis indicates the complexity of endometriosis and the limited global funding available ( 83 ). Despite these issues, endometriosis research has been undertaken by talented researchers, and there are many promising avenues for further endometriosis research.

New Biomarker Analysis

One of the key aspects impacting the diagnosis and treatment of endometriosis is the lack of non-invasive diagnostic tools. Biomarkers present an appealing option for non-invasive diagnosis of endometriosis. However, many biomarkers that have been assessed previously could only discern advanced disease, indicating a need for more research to locate biomarkers that can diagnose “milder” cases of the disease ( 84 ). In a 2021 study, the researchers found patients with endometriosis had distinct microbial communities in their peritoneal fluid and feces compared to the control group. In the peritoneal fluid of endometriosis patients, there were more pathogens, while there was a loss of protective microbes in feces samples ( 85 ). The authors concluded that Ruminococcus in the gut and Pseudomonas in the peritoneal fluid may be able to act as auxiliary diagnostic tools for endometriosis with further investigation into the interactions of micro-organisms and endometriosis required ( 85 ).

Follicular fluid can be obtained from follicles by fine-needle aspiration following oocyte removal ( 5 ). Researchers have found endometriosis patients have dysregulated cytokine profiles in their follicular fluid with significant upregulation of IL-1β and IL-6 ( 86 ). Conversely, the concentration of IL-12, an anti-inflammatory cytokine, inflammatory cytokine IL-10 and E-cadherin levels were lower among endometriosis patients compared to controls ( 5 ). In a 2021 study, the measurement of IL-10 in follicular fluid was able to perfectly differentiate between endometriosis patients and controls ( 5 ).

Nanomedicines

One technology in its infancy for the treatment of endometriosis is the use of nanoparticles to aid in the imaging of, directly treating or delivering drugs to treat endometriosis ( 87 ). The key limitation for this emerging technology is that the etiology and pathogenesis of endometriosis are unknown ( 87 ). Despite this, investment in nanomedicines for endometriosis could substantially augment the capacity to diagnose and treat endometriosis. Nanoparticles have shown a capacity to accumulate in endometriotic lesions ( 87 ), which could improve the use of imaging technologies to diagnose endometriosis. This technology could also provide a method for targeting endometriotic lesions without the requirement of surgery. Potential drugs that could be delivered by nanotechnological methods could be anti-inflammatory, antioxidant, anti-angiogenic and immunomodulating molecules ( 88 ), which may have the capacity to reduce the size of or eliminate endometriosis lesions, rather than just suppress symptoms. However, much more pre-clinical and clinical research is required to support the use of this emerging technology for endometriosis ( 88 ).

Alterations to the Microbiome

Imbalances to gut microbiota composition have been connected to the compromised immunosurveillance and altered immune profiles associated with endometriosis ( 89 ), with animal studies consistently showing the impact of the gut microbiota on endometriosis and endometriosis on gut microbiota ( 90 ). In addition to being a potential site for novel biomarkers, the gut microbiota may be a target site for new treatments. In a 2019 study by Chadchan et al., mice with induced endometriosis were subjected to antibiotic therapies ( 91 ). Broad-spectrum antibiotics were shown to significantly reduce lesion size and inflammatory response. Furthermore, the authors showed that fecal transfer from mice with endometriosis restored lesion growth and inflammation in mice treated with the antibiotic metronidazole ( 91 ). Conversely, metronidazole-treated mice that received fecal transfers from mice without endometriosis had significantly smaller lesions, suggesting a role for the gut microbiome in the progression of endometriosis ( 91 ). The effect of gut microbiota on endometriosis is not solely negative. The bacteria-derived metabolite n-butyrate is a short-chain fatty acid that is significantly downregulated in mice with induced endometriosis. In a 2021 study, n-butyrate treatment significantly reduced lesion growth and inflammatory cell infiltration in a mouse model ( 92 ). Therapies that address endometriotic alterations to the gut microbiota could have immense potential to reduce the growth of lesions and the effects of inflammation for endometriosis patients.

Despite progress, critical gaps remain in the fundamental understanding of endometriosis. This means there are opportunities to substantially expand and improve our core understanding of this important health topic. The authors feel endometriosis warrants more attention to fill these fundamental knowledge gaps. There are not enough people working in this vital space, likely due to insufficient funding. If endometriosis was funded by the NIH at half the level of diabetes, the budget would increase almost 16 times to over $250.4 million annually. It is the belief of the authors that present levels of endometriosis funding do not reflect the immense pain of patients, long delays in diagnosis, the ineffectiveness of common treatment options, massive knowledge gaps, substantial economic burdens or the immense costs borne by individual patients. Unexplored in the scope of this paper, but vital, is the investment into structures to translate research findings into clinical care, understanding of the epidemiological underpinnings of patient diversity, increased awareness through public education about endometriosis so affected patients are better aware, and into healthcare practitioner training about how best to treat and support endometriosis patients.

There is a lot of promising research underway that could create substantial positive ramifications for patients. These include the chance for non-invasive biomarker auxiliary diagnosis methods, the application of nanoparticle drug delivery and treatments targeting the microbiome. An area of immense potential for developing new non-invasive diagnostic and treatment options may be the application of nanoparticles to deliver therapies directly to endometriotic lesions.

Advancement in the identification and treatment of endometriosis is challenging but entirely possible. It is the opinion of these authors that if endometriosis had more representative funding, the rate of advancement of non-invasive diagnostic and treatment methods could be significantly increased, with long-term benefits for patients and society.

Data Availability Statement

Author contributions.

KE is the first author of this paper through conception and literature collection. DM and JC have contributed equally to this work by critically revising and editing the article. All authors contributed to the article and approved the submitted version.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher's Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Acknowledgments

The authors would like to acknowledge the Biomolecular Interaction Centre (BIC) for their support and financial contribution to the Engineering Endometriosis Research Program at the University of Canterbury.

• Diversity in Clinical Research
• Clinical Research for Older Populations
• Clinical Research for Compensation
• Clinical Trial Information for Parents
• What Is A Clinical Trial?

Endometriosis Clinical Trials

Match to clinical trials, browse by state.

This content is for informational and educational purposes only. It is not intended to provide medical advice or to take the place of such advice or treatment from a personal physician. All readers/viewers of this content are advised to consult their doctors or qualified health professionals regarding specific health questions. Policylab.us does not take responsibility for possible health consequences of any person or persons reading or following the information in this educational content. All viewers of this content, especially those taking prescription or over-the-counter medications, should consult their physicians before beginning any nutrition, supplement or lifestyle program

• Open access
• Published: 02 September 2024

Clinical supervisor’s experiences of peer group clinical supervision during COVID-19: a mixed methods study

• Owen Doody   ORCID: orcid.org/0000-0002-3708-1647 1 ,
• Kathleen Markey   ORCID: orcid.org/0000-0002-3024-0828 1 ,
• James Turner   ORCID: orcid.org/0000-0002-8360-1420 2 ,
• Claire O. Donnell   ORCID: orcid.org/0000-0003-2386-7048 1 &
• Louise Murphy   ORCID: orcid.org/0000-0003-2381-3963 1  

BMC Nursing volume  23 , Article number:  612 ( 2024 ) Cite this article

Metrics details

Providing positive and supportive environments for nurses and midwives working in ever-changing and complex healthcare services is paramount. Clinical supervision is one approach that nurtures and supports professional guidance, ethical practice, and personal development, which impacts positively on staff morale and standards of care delivery. In the context of this study, peer group clinical supervision provides allocated time to reflect and discuss care provided and facilitated by clinical supervisors who are at the same grade/level as the supervisees.

To explore the clinical supervisor’s experiences of peer group clinical supervision a mixed methods study design was utilised within Irish health services (midwifery, intellectual disability, general, mental health). The Manchester Clinical Supervision Scale was used to survey clinical supervisors ( n  = 36) and semi-structured interviews ( n  = 10) with clinical supervisors were conducted. Survey data were analysed through SPSS and interview data were analysed utilising content analysis. The qualitative and quantitative data’s reporting rigour was guided by the CROSS and SRQR guidelines.

Participants generally had a positive encounter when providing clinical supervision. They highly appreciated the value of clinical supervision and expressed a considerable degree of contentment with the supervision they provided to supervisees. The advantages of peer group clinical supervision encompass aspects related to self (such as confidence, leadership, personal development, and resilience), service and organisation (including a positive working environment, employee retention, and safety), and patient care (involving critical thinking and evaluation, patient safety, adherence to quality standards, and elevated levels of care).

There are many benefits of peer group clinical supervision at an individual, service, organisation, and patient level. Nevertheless, there is a need to address a lack of awareness and misconceptions surrounding clinical supervision to create an environment and culture conducive to realising its full potential. It is crucial that clinical supervision be accessible to nurses and midwives of all grades across all healthcare services, with national planning to address capacity and sustainability.

Peer Review reports

Within a dynamic healthcare system, nurses and midwives face growing demands, underscoring the necessity for ongoing personal and professional development. This is essential to improve the effectiveness and efficiency of care delivery for patients, families, and societies. Despite the increased emphasis on increasing the quality and safety of healthcare services and delivery, there is evidence highlighting declining standards of nursing and midwifery care [ 1 ]. The recent focus on re-affirming and re-committing to core values guiding nursing and midwifery practice is encouraging such as compassion, care and commitment [ 2 ], competence, communication, and courage [ 3 ]. However, imposing value statements in isolation is unlikely to change behaviours and greater consideration needs to be given to ways in which compassion, care, and commitment are nurtured and ultimately applied in daily practice. Furthermore, concerns have been raised about global staff shortages [ 4 ], the evidence suggesting several contributing factors such as poor workforce planning [ 5 ], job dissatisfaction [ 6 ], and healthcare migration [ 7 ]. Without adequate resources and staffing, compromising standards of care and threats to patient safety will be imminent therefore the importance of developing effective strategies for retaining competent registered nurses and midwives is paramount in today’s climate of increased staff shortages [ 4 ]. Clinical supervision serves as a means to facilitate these advancements and has been linked to heightened job satisfaction, enhanced staff retention, improved staff effectiveness, and effective clinical governance, by aiding in quality improvements, risk management, and heightened accountability [ 8 ].

Clinical supervision is a key component of professional practice and while the aim is largely known, there is no universally accepted definition of clinical supervision [ 8 ]. Clinical supervision is a structured process where clinicians are allowed protected time to reflect on their practice within a supportive environment and with the purpose of developing high-quality clinical care [ 9 ]. Recent literature published on clinical supervision [ 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 ] highlights the advantages and merits of clinical supervision. However, there are challenges also identified such as a lack of consensus regarding the meaning and goal, implementation issues, variations in approaches in its operationalisation, and an absence of research evidence on its effectiveness. Duration and experience in clinical supervision link to positive benefits [ 8 ], but there is little evidence of how clinical supervision altered individual behaviours and practices. This is reinforced by Kuhne et al., [ 15 ] who emphasise that satisfaction rather than effectiveness is more commonly examined. It is crucial to emphasise that reviews have pinpointed that clinical supervision lowers the risks of adverse patient outcomes [ 9 ] and demonstrates enhancements in the execution of certain care processes. Peer group clinical supervision is a form of clinical supervision whereby two or more practitioners engage in a supervision or consultation process to improve their professional practice [ 17 ]. There is limited evidence regarding peer group clinical supervision and research on the experiences of peer clinical supervision and stakeholders is needed [ 13 ]. In Ireland, peer group clinical supervision has been recommended and guidelines have been developed [ 18 ]. In the Irish context, peer clinical supervision is where both clinical supervisees and clinical supervisors are peers at the same level/grade. However, greater evidence is required to inform future decisions on the implementation of peer group clinical supervision and the purpose of this study is to explore clinical supervisors’ experiences of peer group clinical supervision. As the focus is on peer group supervisors and utilising mixed methods the experiences of the other stakeholders were investigated and reported separately.

A mixed methods approach was used (survey and semi-structured interviews) to capture clinical supervisor’s experiences of clinical supervision. The study adhered to the Consensus-Based Checklist for Reporting of Survey Studies guidelines [ 19 ] (Supplementary File S1 ) and Standards for Reporting Qualitative Research guidelines [ 20 ] (Supplementary File S2 ).

Participants

This study was conducted with participants who successfully completed a professionally credited award: clinical supervision module run by a university in Ireland (74 clinical supervisors across 5 programmes over 3 years). The specific selection criteria for participants were that they were registered nurses/midwives delivering peer group clinical supervision within the West region of Ireland. The specific exclusion criteria were as follows: (1) nurses and midwives who haven’t finished the clinical supervision module at the University, (2) newly appointed peer group clinical supervisors who have yet to establish their groups and initiate the delivery of peer group clinical supervision.

Measures and procedures

The Manchester Clinical Supervision Scale-26 was used to survey participants in February/March 2022 and measure the peer group clinical supervisors’ overall experiences of facilitating peer group clinical supervision. The Manchester Clinical Supervision Scale-26 is a validated 26-item self-report questionnaire with a Likert-type (1–5) scale ranging from strongly disagree (1) to strongly agree (5) [ 21 ]. The Manchester Clinical Supervision Scale-26 measures the efficiency of and satisfaction with supervision, to investigate the skills acquisition aspect of clinical supervision and its effect on the quality of clinical care [ 21 ]. The instrument consists of two main sections to measure three (normative, restorative, and formative) dimensions of clinical supervision utilising six sub-scales: (1) trust and rapport, (2) supervisor advice/support, (3) improved care/skills, (4) importance/value of clinical supervision, (5) finding time, (6) personal issues/reflections and a total score for the Manchester Clinical Supervision Scale-26 is also calculated. Section two consisted of the demographic section of the questionnaire and was tailored to include eight demographic questions concerning the supervisor’s demographics, supervisee characteristics, and characteristics of clinical supervision sessions. There were also two open field questions on the Manchester Clinical Supervision Scale-26 (model of clinical supervision used and any other comments about experience of peer group clinical supervision). The main question about participants’ experiences with peer clinical supervision was “What was your experience of peer clinical supervision?” This was gathered through individual semi-structured interviews lasting between 20 and 45 min, in March/April 2022 (Supplementary file 3 ).

Ethical considerations

Health service institutional review boards of two University hospitals approved this study (Ref: 091/19 and Ref: C.A. 2199). Participants were recruited after receiving a full explanation of the study’s purpose and procedure and all relevant information. Participants were aware of potential risks and benefits and could withdraw from the study, or the survey could be stopped at any time. Informed consent was recorded, and participant identities were protected by using a pseudonym to protect anonymity.

Data analysis method

Survey data was analysed using the data analysis software package Statistical Package for the Social Sciences, version 26 (SPSS Inc., Chicago, Il, USA). Descriptive analysis was undertaken to summarise responses to all items and categorical variables (nominal and ordinal) were analysed using frequencies to detail the number and percentage of responses to each question. Scores on the Manchester Clinical Supervision Scale-26 were reverse scored for 9 items (Q1-Q6, Q8, Q20,21) and total scores for each of the six sub-scales were calculated by adding the scores for each item. Raw scores for the individual sub-scales varied in range from 0 to 20 and these raw scores were then converted to percentages which were used in addition to the raw scores for each sub-scale to describe and summarise the results of the Manchester Clinical Supervision Scale-26. Cronbach’s alpha coefficient was undertaken with the 26 questions included within the Manchester Clinical Supervision Scale-26 and more importantly with each of the dimensions in the Manchester Clinical Supervision Scale-26. The open-ended questions on the Manchester Clinical Supervision Scale-26 and interviews were analysed using content analysis guided by Colorafi and Evans [ 22 ] and categories were generated using their eight steps, (1) creating a coding framework, (2) adding codes and memos, (3) applying the first level of coding, (4) categorising codes and applying the second level of coding, (5) revising and redefining the codes, (6) adding memos, (7) visualising data and (8) representing the data.

Research rigour

To ensure the validity and rigour of this study the researchers utilised the Manchester Clinical Supervision Scale-26 a recognised clinical supervision tool with good reliability and wide usage. Interviews were recorded, transcribed, and verified by four participants, data were collected until no new components appeared, data collection methods and analysis procedures were described, and the authors’ biases were minimised throughout the research process. The Manchester Clinical Supervision Scale-26 instrument internal consistency reliability was assessed which was overall good (α = 0.878) with individual subscale also good e.g., normative domain 0.765, restorative domain 0.864, and formative domain 0.900. Reporting rigour was demonstrated using the Consensus-Based Checklist for Reporting of Survey Studies guidelines [ 19 ] and Standards for Reporting Qualitative Research guidelines [ 20 ].

Quantitative data

Participant and clinical supervision characteristics.

Thirty-six of the fifty-two (69.2%) peer group clinical supervisors working across a particular region of Ireland responded to the Manchester Clinical Supervision Scale-26 survey online via Qualtrics. Table 1 identifies the demographics of the sample who were predominantly female (94.4%) with a mean age of 44.7 years (SD. 7.63).

Peer group clinical supervision session characteristics (Table  2 ) highlight over half of peer group clinical supervisors ( n  = 20, 55.6%) had been delivering peer group clinical supervision for less than one year and were mainly delivered to female supervisees ( n  = 28, 77.8%). Most peer group clinical supervision sessions took place monthly ( n  = 32, 88.9%) for 31–60 min ( n  = 27, 75%).

Manchester Clinical Supervision Scale-26 results

Participants generally viewed peer group clinical supervision as effective (Table  3 ), the total mean Manchester Clinical Supervision Scale-26 score among all peer group clinical supervisors was 76.47 (SD. 12.801) out of 104, Surpassing the clinical supervision threshold score of 73, which was established by the developers of the Manchester Clinical Supervision Scale-26 as the benchmark indicating proficient clinical supervision provision [ 21 ]. Of the three domains; normative, formative, and restorative, the restorative domain scored the highest (mean 28.56, SD. 6.67). The mean scores compare favourably to that of the Manchester Clinical Supervision Scale-26 benchmark data and suggest that the peer group clinical supervisors were satisfied with both the level of support, encouragement, and guidance they provided and the level of trust/rapport they had developed during the peer group clinical supervision sessions. 83.3% ( n  = 30) of peer group clinical supervisors reported being either very satisfied ( n  = 12, 33.3%) or moderately satisfied ( n  = 18, 50%) with the peer group clinical supervision they currently delivered. Within the peer group clinical supervisor’s supervisee related issues ( n  = 17, 47.2%), work environment-related issues ( n  = 16, 44.4%), staff-related issues ( n  = 15, 41.7%) were reported as the most frequent issues, with patient/client related issues being less frequent ( n  = 8, 22.2%). The most identified model used to facilitate peer group clinical supervision was the Proctors model ( n  = 8, 22.22%), which was followed by group ( n  = 2, 5.55%), peer ( n  = 2, 5.55%), and a combination of the seven-eyed model of clinical supervision and Proctors model ( n  = 1, 2.77%) with some not sure what model they used ( n  = 2, 5.553%) and 58.33% ( n  = 21) did not report what model they used.

Survey open-ended question

‘Please enter any additional comments , which are related to your current experience of delivering Peer Group Clinical Supervision.’ There were 22 response comments to this question, which represented 61.1% of the 36 survey respondents, which were analysed using content analysis guided by Colorafi & Evans [ 22 ]. Three categories were generated. These included: personal value/benefit of peer group clinical supervision, challenges with facilitating peer group clinical supervision, and new to peer group clinical supervision.

The first category ‘personal value/benefit of peer group clinical supervision’ highlighted positive experiences of both receiving and providing peer group clinical supervision. Peer group clinical supervisors reported that they enjoyed the sessions and found them both worthwhile and beneficial for both the group and them as peer group clinical supervisors in terms of creating a trusted supportive group environment and motivation to develop. Peer group clinical supervision was highlighted as very important for the peer group clinical supervisors working lives and they hoped that there would be more uptake from all staff. One peer group clinical supervisor expressed that external clinical supervision was a ‘lifeline’ to shaping their supervisory journey to date.

The second category ‘challenges with facilitating peer group clinical supervision’, identified time constraints, lack of buy-in/support from management, staff shortages, lack of commitment by supervisees, and COVID-19 pandemic restrictions and related sick leave, as potential barriers to facilitating peer group clinical supervision. COVID-19 was perceived to have a negative impact on peer group clinical supervision sessions due to staff shortages, which resulted in difficulties for supervisees attending the sessions during work time. Peer group clinical supervisors felt that peer group clinical supervision was not supported by management and there was limited ‘buy-in’ at times. There was also a feeling expressed that peer group clinical supervision was in its infancy, as COVID-19 and its related restrictions impacted on this by either slowing down the process of commencing peer group clinical supervision in certain areas or having to move online. However, more recently improvements in managerial support and supervisee engagement with the peer group clinical supervision process are noted.

The final category ‘new to peer group clinical supervision’ highlighted that some peer group clinical supervisors were new to the process of providing peer group clinical supervision and some felt that this survey was not a true reflection of their experience of delivering peer group clinical supervision, as they were not fully established yet as clinical supervisors due to the impact of COVID-19. Peer group clinical supervisors identified that while they were new to providing peer group clinical supervision, they were enjoying it and that it was a learning curve for them.

Qualitative data

The qualitative phase explored peer group clinical supervisors’ ( n  = 10) own experiences of preparation received and experiences of being a peer group clinical supervisor. Three themes were identified through data analysis, building the foundations, enacting engagement and actions, and realities (Table  4 ).

Building the foundations

This theme highlights the importance of prior knowledge, awareness, and training but also the recruitment process and education in preparing peer group clinical supervisors.

Knowledge and awareness

Participant’s prior knowledge and awareness of peer group clinical supervision was mixed with some reporting having little or no knowledge of clinical supervision.

I’m 20 years plus trained as a nurse , and I had no awareness of clinical supervision beforehand , I really hadn’t got a clue what all of this was about , so it was a very new concept to me (Bernie) .

Others were excited about peer group clinical supervision and while they could see the need they were aware that there may be limited awareness of the value and process of clinical supervision among peers.

I find that there’s great enthusiasm and passion for clinical supervision as it’s a great support mechanism for staff in practice , however , there’s a lack of awareness of clinical supervision (Jane) .

Recruitment

Some participants highlighted that the recruitment process to become a peer group clinical supervisor was vague in some organisations with an unclear and non-transparent process evident where people were chosen by the organisation’s management rather than self-selecting interested parties.

It was just the way the training was put to the people , they were kind of nominated and told they were going and there was a lot of upset over that , so they ended up in some not going at all (Ailbhe) .

In addition, the recruitment process was seen as top loaded where senior grades of staff were chosen, and this limited staff nurse grade opportunities where there was a clear need for peer group clinical supervisors and support.

We haven’t got down to the ground level like you know we’ve done the directors , we’ve done the CNM3s the CNM2s we are at the CNM1s , so we need to get down to the staff nurse level so the nurses at the direct frontline are left out and aren’t receiving supervision because we don’t have them trained (Bernie) .

Training and education

Participants valued the training and education provided but there was a clear sense of ‘imposter syndrome’ for some peer group clinical supervisors starting out. Participants questioned their qualifications, training duration, and confidence to undertake the role of peer group clinical supervisor.

Because it is group supervision and I know that you know they say that we are qualified to do supervision and you know we’re now qualified clinical supervisors but I’m not sure that a three-month module qualifies you to be at the top of your game (Maria) .

Participants when engaged in the peer group clinical supervisor educational programme did find it beneficial and the true benefit was the actual re-engagement in education and published evidence along with the mix of nursing and midwifery practice areas.

I found it very beneficial , I mean I hadn’t been engaged in education here in a while , so it was great to be back in that field and you know with the literature that’s big (Claire) .

Enacting engagement and actions

This theme highlights the importance of forming the groups, getting a clear message out, setting the scene, and grounding the group.

Forming the groups

Recruitment for the group was of key importance to the peer group clinical supervisor and they all sent out a general invitation to form their group. Some supervisors used invitation letters or posters in addition to a general email and this was effective in recruiting supervisees.

You’re reaching out to people , I linked in with the ADoN and I put together a poster and circulated that I wasn’t ‘cherry picking , and I set up a meeting through Webex so people could get a sense of what it was if they were on the fence about it or unsure if it was for them (Karen) .

In forming the peer clinical supervision groups consideration needs to be given to the actual number of supervisees and participants reported four to six supervisees as ideal but that number can alter due to attendance.

The ideal is having five or six consistent people and that they all come on board and that you get the dynamics of the group and everything working (Claire) .

Getting a clear message out

Within the recruitment process, it was evident that there was a limited and often misguided understanding or perception of peer group clinical supervision.

Greater awareness of what actually clinical supervision is , people misjudge it as a supervision where someone is appraising you , when in fact it is more of a support mechanism , I think peer support is the key element that needs to be brought out (Jane) .

Given the lack of clarity and understanding regarding peer group clinical supervision, the participants felt strongly that further clarity is needed and that the focus needs to be on the support it offers to self, practice, and the profession.

Clinical supervision to me is clinical leadership (Jane) .

Setting the scene and grounding the group

In the initial phase of the group coming together the aspect of setting the scene and grounding the group was seen as important. A key aspect of this process was establishing the ground rules which not only set the boundaries and gave structure but also ensured the adoption of principles of trust, confidentiality, and safety.

We start with the ground rules , they give us structure it’s our contract setting out the commitment the expectation for us all , and the confidentiality as that’s so important to the trust and safety and building the relationships (Brid) .

Awareness of group dynamics is important in this process along with awareness of the group members (supervisees) as to their role and expectations.

I reiterate the role of each person in relation to confidentiality and the relationship that they would have with each other within the group and the group is very much aware that it is based on respect for each person’s point of view people may have a fear of contributing to the group and setting the ground rules is important (Jane) .

To ground the group, peer group clinical supervisors saw the importance of being present and allowing oneself to be in the room. This was evident in the time allocated at the start of each session to allow ‘grounding’ to occur in the form of techniques such as a short meditation, relaxation, or deep breathing.

At the start , I do a bit of relaxation and deep breathing , and I saw that with our own external supervisor how she settled us into place so very much about connecting with your body and you’ve arrived , then always come in with the contract in my first sentence , remember today you know we’re in a confidential space , of course , you can take away information , but the only information you will take from today is your own information and then the respect aspect (Mary Rose) .

This settling in and grounding was seen as necessary for people to feel comfortable and engage in the peer group clinical supervision process where they could focus, be open, converse, and be aware of their role and the role of peer group clinical supervision.

People have to be open, open about their practice and be willing to learn and this can only occur by sharing, clinical supervision gives us the space to do it in a space where we know we will be respected, and we can trust (Claire) .

This theme highlights the importance of the peer group clinical supervisors’ past experiences, delivering peer group clinical supervision sessions, responding to COVID-19, personal and professional development, and future opportunities.

Past experiences

Past experiences of peer group clinical supervisors were not always positive and for one participant this related to the lack of ground rules or focus of the sessions and the fact it was facilitated by a non-nurse.

In the past , I suppose I would have found it very frustrating as a participant because I just found that it was going round in circles , people moaning and you know it wasn’t very solution focused so I came from my situation where I was very frustrated with clinical supervision , it was facilitated by somebody that was non-nursing then it wasn’t very , there wasn’t the ground rules , it was very loose (Caroline) .

However, many did not have prior experience of peer group clinical supervision. Nonetheless, through the education and preparation received, there was a sense of commitment to embrace the concept, practice, and philosophy.

I did not really have any exposure or really much information on clinical supervision , but it has opened my eyes , and as one might say I am now a believer (Brid) .

Delivering peer group clinical supervision

In delivering peer group clinical supervision, participants felt supervisees were wary, as they did not know what peer group clinical supervision was, and they had focused more on the word supervision which was misleading to them. Nonetheless, the process was challenging, and buy-in was questioned at an individual and managerial level.

Buy-in wasn’t great I think now of course people will blame the pandemic , but this all happened before the pandemic , there didn’t seem to be you know , the same support from management that I would have expected so I kind of understood it in a way because then there wasn’t the same real respect from the practitioners either (Mary Rose) .

From the peer group clinical supervisor’s perspective, they were all novices in delivering/facilitating peer group clinical supervision sessions, and the support of the external clinical supervisors, and their own peer group clinical supervision sessions were invaluable along with a clinical supervision model.

Having supervision myself was key and something that is vital and needed , we all need to look at our practice and how we work it’s no good just facilitating others without being part of the process yourself but for me I would say the three principles of clinical supervision , you know the normative , formative and restorative , I keep hammering that home and bring that in regularly and revisit the contract and I have to do that often you know (Claire) .

All peer group clinical supervisors commented on the preparation for their peer group clinical supervision sessions and the importance of them having the right frame of mind and that often they needed to read over their course work and published evidence.

I want everybody to have a shared voice and you know that if one person , there is something that somebody feels very strongly and wants to talk about it that they e-mail in advance like we don’t have a set agenda but that’s agreed from the participant at the start (Caroline) .

To assist this, the peer group clinical supervisors noted the importance of their own peer group clinical supervision, the support of their peers, and external clinical supervisors. This preparation in an unpredictable situation can be difficult but drawing on one’s experience and the experience within the group can assist in navigating beyond unexpected situations.

I utilise the models of clinical supervision and this helps guide me , I am more of a facilitator of the group we are experts in our own area and our own role but you can only be an expert if you take the time to examine your practice and how you operate in your role (Brid) .

All clinical supervisors noted that the early sessions can be superficial, and the focus can be on other practice or management issues, but as time moves on and people become more engaged and involved it becomes easier as their understanding of supervision becomes clearer. In addition, there may be hesitancy and people may have difficulty opening up with certain people in the group and this is a reality that can put people off.

Initially there was so much managerial bashing and I think through supervision , I began to kind of think , I need the pillars of supervision , the governance , bringing more knowledge and it shifted everything in the room , trying to marry it with all the tensions that people have (Mary Rose) .

For some clinical supervisors, there were expected and unexpected challenges for them as clinical supervisors in terms of the discussions veering off course and expectations of their own ability.

The other big challenge is when they go off , how do you bring him back , you know when they veer off and you’re expected to be a peer , but you have to try and recoil that you have to get the balance with that right (Mary Rose) .

While peer group clinical supervision is accepted and seen as a valuable process by the peer group clinical supervisors, facilitating peer group supervision with people known to you can be difficult and may affect the process.

I’d love to supervise a group where I actually don’t know the people , I don’t know the dynamics within the group , and I’d love to see what it would be like in a group (Bernie) .

Of concern to clinical supervisors was the aspect of non-attendance and while there may be valid reasons such as COVID-19 the absence of a supervisee for several sessions can affect the group dynamics, especially if the supervisee has only engaged with early group sessions.

One of the ones that couldn’t attend because of COVID and whatever , but she’s coming to the next one and I just feel there’s a lot of issues in her area and I suppose I’m mindful that I don’t want that sort of thing to seep in , so I suppose it’s just for me just to keep reiterating the ground rules and the boundaries , that’s something I just have to manage as a facilitator , but what if they don’t attend how far will the group have progressed before she attends (Caroline) .

Responding to COVID-19

The advent of COVID-19 forced peer group clinical supervisors to find alternative means of providing peer group clinical supervision sessions which saw the move from face-to-face to online sessions. The online transition was seen as seamless for many established groups while others struggled to deliver sessions.

With COVID we did online for us it was fine because we were already formed (Corina) .

While the transition may have been positive many clinical supervisors came across issues because they were using an online format that would not be present in the face-to-face session.

We did have a session where somebody was in the main office and they have a really loud booming voice and they were saying stuff that was not appropriate to say outside of clinical supervision and I was like are you in the office can you lower it down a bit can you put your headphones on (Maria) .

However, two peer group clinical supervisors ceased or hasted the progress of rolling out peer group clinical supervision sessions mainly due to redeployment and staff availability.

With COVID it just had to be canceled here , it’s just the whole thing was canceled so it was very , very difficult for people (Mary Rose) .

It was clear from clinical supervisors that online sessions were appropriate but that they felt they were only appropriate for existing established groups that have had the opportunity to build relationships, develop trust, embed the ground rules, and create the space for open communication and once established a combined approach would be appropriate.

Since we weren’t as established as a group , not everybody knew each other it would be difficult to establish that so we would hold off/reschedule , obviously COVID is a major one but also I suppose if you have an established group now , and again , you could go to a remote one , but I felt like since we weren’t established as a group it would be difficult to develop it in that way (Karen) .

Within practice COVID-19 took priority and other aspects such as peer group clinical supervision moved lower down on the priority list for managers but not for the clinical supervisors even where redeployment occurred.

With COVID all the practical side , if one of the managers is dealing with an outbreak , they won’t be attending clinical supervision , because that has to be prioritised , whereas we’ve prioritised clinical supervision (Maria) .

The valuing of peer group clinical supervision was seen as important by clinical supervisors, and they saw it as particularly needed during COVID-19 as staff were dealing with many personal and professional issues.

During the height of COVID , we had to take a bit of a break for four months as things were so demanding at work for people but then I realised that clinical supervision was needed and started back up and they all wanted to come back (Brid) .

Having peer group clinical supervision during COVID-19 supported staff and enabled the group to form supportive relationships.

COVID has impacted over the last two years in every shape and they needed the supervision and the opportunity to have a safe supportive space and it gelled the group I think as we all were there for each other (Claire) .

While COVID-19 posed many challenges it also afforded clinical supervisors and supervisees the opportunity for change and to consider alternative means of running peer group clinical supervision sessions. This change resulted in online delivery and in reflecting on both forms of delivery (face-to-face and online) clinical supervisors saw the benefit in both. Face-to-face was seen as being needed to form the group and then the group could move online once the group was established with an occasional periodic face-to-face session to maintain motivation commitment and reinforce relationships and support.

Online formats can be effective if the group is already established or the group has gone through the storming and forming phase and the ground rules have been set and trust built , then I don’t see any problem with a blended online version of clinical supervision , and I think it will be effective (Jane) .

Personal and professional development

Growth and development were evident from peer group clinical supervisors’ experiences and this growth and development occurred at a personal, professional, and patient/client level. This development also produced an awakening and valuing of one’s passion for self and their profession.

I suppose clinical supervision is about development I can see a lot of development for me and my supervisees , you know personally and professionally , it’s the support really , clinical supervision can reinvigorate it’s very exciting and a great opportunity for nursing to support each other and in care provision (Claire) .

A key to the peer group clinical supervisor’s development was the aspect of transferable skills and the confidence they gained in fulfilling their role.

All of these skills that you learn are transferable and I am a better manager because of clinical supervision (Maria) .

The confidence and skills gained translated into the clinical supervisor’s own practice as a clinical practitioner and clinical supervisor but they were also realistic in predicting the impact on others.

I have empowered my staff , I empower them to use their voice and I give my supervisees a voice and hope they take that with them (Corina) .

Fundamental to the development process was the impact on care itself and while this cannot always be measured or identified, the clinical supervisors could see that care and support of the individual practitioner (supervisee) translated into better care for the patient/client.

Care is only as good as the person delivering it and what they know , how they function and what energy and passion they have , and clinical supervision gives the person support to begin to understand their practice and how and why they do things in a certain way and when they do that they can begin to question and even change their way of doing something (Brid) .

Future opportunities

Based on the clinical supervisor’s experiences there was a clear need identified regarding valuing and embedded peer group clinical supervision within nursing/midwifery practice.

There has to be an emphasis placed on supervision it needs to be part of the fabric of a service and valued by all in that service , we should be asking why is it not available if it’s not there but there is some work first on promoting it and people knowing what it actually is and address the misconceptions (Claire) .

While such valuing and buy-in are important, it is not to say that all staff need to have peer group clinical supervision so as to allow for personal choice. In addition, to value peer group clinical supervision it needs to be evident across all staffing grades and one could question where the best starting point is.

While we should not mandate that all staff do clinical supervision it should become embedded within practice more and I suppose really to become part of our custom and practice and be across all levels of staff (Brid) .

When peer group clinical supervision is embedded within practice then it should be custom and practice, where it is included in all staff orientations and is nationally driven.

I suppose we need to be driving it forward at the coal face at induction , at orientation and any development for the future will have to be driven by the NMPDUs or nationally (Ailbhe) .

A formalised process needs to address the release of peer group clinical supervisors but also the necessity to consider the number of peer group clinical supervisors at a particular grade.

The issue is release and the timeframe as they have a group but they also have their external supervision so you have to really work out how much time you’re talking about (Maria) .

Vital within the process of peer group clinical supervision is receiving peer group clinical supervision and peer support and this needs to underpin good peer group clinical supervision practice.

Receiving peer group supervision helps me , there are times where I would doubt myself , it’s good to have the other group that I can go to and put it out there to my own group and say , look at this , this is what we did , or this is what came up and this is how (Bernie) .

For future roll out to staff nurse/midwife grade resourcing needs to be considered as peer group clinical supervisors who were managers could see the impact of having several peer group clinical supervisors in their practice area may have on care delivery.

Facilitating groups is an issue and needs to be looked at in terms of the bigger picture because while I might be able to do a second group the question is how I would be supported and released to do so (Maria) .

While there was ambiguity regarding peer group clinical supervision there was an awareness of other disciplines availing of peer group clinical supervision, raising questions about the equality of supports available for all disciplines.

I always heard other disciplines like social workers would always have been very good saying I can’t meet you I have supervision that day and I used to think my God what’s this fabulous hour that these disciplines are getting and as a nursing staff it just wasn’t there and available (Bernie) .

To address this equity issue and the aspect of low numbers of certain grades an interdisciplinary approach within nursing and midwifery could be used or a broader interdisciplinary approach across all healthcare professionals. An interdisciplinary or across-services approach was seen as potentially fruitful.

I think the value of interprofessional or interdisciplinary learning is key it addresses problem-solving from different perspectives that mix within the group is important for cross-fertilisation and embedding the learning and developing the experience for each participant within the group (Jane) .

As we move beyond COVID-19 and into the future there is a need to actively promote peer group clinical supervision and this would clarify what peer group clinical supervision actually is, its uptake and stimulate interest.

I’d say it’s like promoting vaccinations if you could do a roadshow with people , I think that would be very beneficial , and to launch it , like you have a launch an official launch behind it (Mary Rose) .

The advantages of peer group clinical supervision highlighted in this study pertain to self-enhancement (confidence, leadership, personal development, resilience), organisational and service-related aspects (positive work environment, staff retention, safety), and professional patient care (critical thinking and evaluation, patient safety, adherence to quality standards, elevated care standards). These findings align with broader literature that acknowledges various areas, including self-confidence and facilitation [ 23 ], leadership [ 24 ], personal development [ 25 ], resilience [ 26 ], positive/supportive working environment [ 27 ], staff retention [ 28 ], sense of safety [ 29 ], critical thinking and evaluation [ 30 ], patient safety [ 31 ], quality standards [ 32 ] and increased standards of care [ 33 ].

In this study, peer group clinical supervision appeared to contribute to the alleviation of stress and anxiety. Participants recognised the significance of these sessions, where they could openly discuss and reflect on professional situations both emotionally and rationally. Central to these discussions was the creation of a safe, trustworthy, and collegial environment, aligning with evidence in the literature [ 34 ]. Clinical supervision provided a platform to share resources (information, knowledge, and skills) and address issues while offering mutual support [ 35 ]. The emergence of COVID-19 has stressed the significance of peer group clinical supervision and support for the nursing/midwifery workforce [ 36 ], highlighting the need to help nurses/midwifes preserve their well-being and participate in collaborative problem-solving. COVID-19 impacted and disrupted clinical supervision frequency, duration and access [ 37 ]. What was evident during COVID-19 was the stress and need for support for staff and given the restorative or supportive functions of clinical supervision it is a mechanism of support. However, clinical supervisors need support themselves to be able to better meet the supervisee’s needs [ 38 ].

The value of peer group clinical supervision in nurturing a conducive working environment cannot be overstated, as it indorses the understanding and adherence to workplace policies by empowering supervisees to understand the importance and rationale behind these policies [ 39 ]. This becomes vital in a continuously changing healthcare landscape, where guidelines and policies may be subject to change, especially in response to situations such as COVID-19. In an era characterised by international workforce mobility and a shortage of healthcare professionals, a supportive and positive working environment through the provision of peer group clinical supervision can positively influence staff retention [ 40 ], enhance job satisfaction [ 41 ], and mitigate burnout [ 42 ]. A critical aspect of the peer group clinical supervision process concerns providing staff the opportunity to reflect, step back, problem-solve and generate solutions. This, in turn, ensures critical thinking and evaluation within clinical supervision, focusing on understanding the issues and context, and problem-solving to draw constructive lessons for the future [ 30 ]. Research has determined a link between clinical supervision and improvements in the quality and standards of care [ 31 ]. Therefore, peer group clinical supervision plays a critical role in enhancing patient safety by nurturing improved communication among staff, facilitating reflection, promoting greater self-awareness, promoting the exchange of ideas, problem-solving, and facilitating collective learning from shared experiences.

Starting a group arose as a foundational aspect emphasised in this study. The creation of the environment through establishing ground rules, building relationships, fostering trust, displaying respect, and upholding confidentiality was evident. Vital to this process is the recruitment of clinical supervisees and deciding the suitable group size, with a specific emphasis on addressing individuals’ inclination to engage, their knowledge and understanding of peer group clinical supervision, and dissipating any lack of awareness or misconceptions regarding peer group supervision. Furthermore, the educational training of peer group clinical supervisors and the support from external clinical supervisors played a vital role in the rollout and formation of peer group clinical supervision. The evidence stresses the significance of an open and safe environment, wherein supervisees feel secure and trust their supervisor. In such an environment, they can effectively reflect on practice and related issues [ 41 ]. This study emphasises that the effectiveness of peer group supervision is more influenced by the process than the content. Clinical supervisors utilised the process to structure their sessions, fostering energy and interest to support their peers and cultivate new insights. For peer group clinical supervision to be effective, regularity is essential. Meetings should be scheduled in advance, allocate protected time, and take place in a private space [ 35 ]. While it is widely acknowledged that clinical supervisors need to be experts in their professional field to be credible, this study highlights that the crucial aspects of supervision lie in the quality of the relationship with the supervisor. The clinical supervisor should be supportive, caring, open, collaborative, sensitive, flexible, helpful, non-judgmental, and focused on tacit knowledge, experiential learning, and providing real-time feedback.

Critical to the success of peer group clinical supervision is the endorsement and support from management, considering the organisational culture and attitudes towards the practice of clinical supervision as an essential factor [ 43 ]. This support and buy-in are necessary at both the management and individual levels [ 28 ]. The primary obstacles to effective supervision often revolve around a lack of time and heavy workloads [ 44 ]. Clinical supervisors frequently struggle to find time amidst busy environments, impacting the flexibility and quality of the sessions [ 45 ]. Time constraints also limit the opportunity for reflection within clinical supervision sessions, leaving supervisees feeling compelled to resolve issues on their own without adequate support [ 45 ]. Nevertheless, time-related challenges are not unexpected, prompting a crucial question about the value placed on clinical supervision and its integration into the culture and fabric of the organisation or profession to make it a customary practice. Learning from experiences like those during the COVID-19 pandemic has introduced alternative ways of working, and the use of technology (such as Zoom, Microsoft Teams, Skype) may serve as a means to address time, resource, and travel issues associated with clinical supervision.

Despite clinical supervision having a long international history, persistent misconceptions require attention. Some of these include not considering clinical supervision a priority [ 46 ], perceiving it as a luxury [ 41 ], deeming it self-indulgent [ 47 ], or viewing it as mere casual conversation during work hours [ 48 ]. A significant challenge lies in the lack of a shared understanding regarding the role and purpose of clinical supervision, with past perceptions associating it with surveillance and being monitored [ 48 ]. These negative connotations often result in a lack of engagement [ 41 ]. Without encouragement and recognition of the importance of clinical supervision from management or the organisation, it is unlikely to become embedded in the organisational culture, impeding its normalisation [ 39 ].

In this study, some peer group clinical supervisors expressed feelings of being impostors and believed they lacked the knowledge, skills, and training to effectively fulfil their roles. While a deficiency in skills and competence are possible obstacles to providing effective clinical supervision [ 49 ], the peer group clinical supervisors in this study did not report such issues. Instead, their concerns were more about questioning their ability to function in the role of a peer group clinical supervisor, especially after a brief training program. The literature acknowledges a lack of training where clinical supervisors may feel unprepared and ill-equipped for their role [ 41 ]. To address these challenges, clinical supervisors need to be well-versed in professional guidelines and ethical standards, have clear roles, and understand the scope of practice and responsibilities associated with being a clinical supervisor [ 41 ].

The support provided by external clinical supervisors and the peer group clinical supervision sessions played a pivotal role in helping peer group clinical supervisors ease into their roles, gain experiential learning, and enhance their facilitation skills within a supportive structure. Educating clinical supervisors is an investment, but it should not be a one-time occurrence. Ongoing external clinical supervision for clinical supervisors [ 50 ] and continuous professional development [ 51 ] are crucial, as they contribute to the likelihood of clinical supervisors remaining in their roles. However, it is important to interpret the results of this study with caution due to the small sample size in the survey. Generalising the study results should be approached with care, particularly as the study was limited to two regions in Ireland. However, the addition of qualitative data in this mixed-methods study may have helped offset this limitation.

This study highlights the numerous advantages of peer group clinical supervision at individual, service, organisational, and patient/client levels. Success hinges on addressing the initial lack of awareness and misconceptions about peer group clinical supervision by creating the right environment and establishing ground rules. To unlock the full potential of peer group clinical supervision, it is imperative to secure management and organisational support for staff release. More crucially, there is a need for valuing and integrating peer group clinical supervision into nursing and midwifery education and practice. Making peer group clinical supervision accessible to all grades of nurses and midwives across various healthcare services is essential, necessitating strategic planning to tackle capacity and sustainability challenges.

Data availability

Data are available from the corresponding author upon request owing to privacy or ethical restrictions.

Zelenikova R, Gurkova E, Friganovic A, Uchmanowicz I, Jarosova D, Ziakova K, Plevova I, Papastavrou E. Unfinished nursing care in four central European countries. J Nurs Manage. 2020;28(8):1888–900. https://doi.org/10.1111/jonm.12896 .

Article   Google Scholar  

Department of Health, Office of the Chief Nursing Officer. Position paper 1: values for nurses and midwives in Ireland. Dublin: The Stationery Office; 2016.

Google Scholar  

Cummings J, Bennett V. Developing the culture of compassionate care: creating a new vision for nurses, midwives and care-givers. London: Department of Health; 2012.

Both-Nwabuwe JM, Dijkstra MT, Klink A, Beersma B. Maldistribution or scarcity of nurses: the devil is in the detail. J Nurs Manage. 2018;26(2):86–93. https://doi.org/10.1111/jonm.12531 .

Squires A, Jylha V, Jun J, Ensio A, Kinnunen J. A scoping review of nursing workforce planning and forecasting research. J Nurs Manage. 2017;25:587–96. https://doi.org/10.1111/jonm.12510 .

Sasso L, Bagnasco A, Catania G, Zanini M, Aleo G, Watson R. Push and pull factors of nurses’ intention to leave. J Nurs Manage. 2019;27:946–54. https://doi.org/10.1111/jonm.12745 .

Gea-Caballero V, Castro-Sánchez E, Díaz‐Herrera MA, Sarabia‐Cobo C, Juárez‐Vela R, Zabaleta‐Del Olmo E. Motivations, beliefs, and expectations of Spanish nurses planning migration for economic reasons: a cross‐sectional, web‐based survey. J Nurs Scholarsh. 2019;51(2):178–86. https://doi.org/10.1111/jnu.12455 .

Article   PubMed   Google Scholar  

Cutcliffe J, Sloan G, Bashaw M. A systematic review of clinical supervision evaluation studies in nursing. Int J Ment Health Nurs. 2018;27:1344–63. https://doi.org/10.1111/inm.12443 .

Snowdon DA, Hau R, Leggat SG, Taylor NF. Does clinical supervision of health professionals improve patient safety? A systematic review and meta-analysis. Int J Qual Health C. 2016;28(4):447–55. https://doi.org/10.1093/intqhc/mzw059 .

Turner J, Hill A. Implementing clinical supervision (part 1): a review of the literature. Ment Health Nurs. 2011;31(3):8–12.

Dilworth S, Higgins I, Parker V, Kelly B, Turner J. Finding a way forward: a literature review on the current debates around clinical supervision. Contemp Nurse. 2013;45(1):22–32. https://doi.org/10.5172/conu.2013.45.1.22 .

Buss N, Gonge H. Empirical studies of clinical supervision in psychiatric nursing: a systematic literature review and methodological critique. Int J Ment Health Nurs. 2009;18(4):250–64. https://doi.org/10.1111/j.1447-0349.2009.00612.x .

Pollock A, Campbell P, Deery R, Fleming M, Rankin J, Sloan G, Cheyne H. A systematic review of evidence relating to clinical supervision for nurses, midwives and allied health professionals. J Adv Nurs. 2017;73(8):1825–37. https://doi.org/10.1111/jan.13253 .

Snowdon DA, Leggat SG, Taylor NF. Does clinical supervision of healthcare professionals improve effectiveness of care and patient experience: a systematic review. BMC Health Serv Res. 2017;17(1):1–11. https://doi.org/10.1186/s12913-017-2739-5 .

Kühne F, Maas J, Wiesenthal S, Weck F. Empirical research in clinical supervision: a systematic review and suggestions for future studies. BMC Psychol. 2019;7(1):1–11. https://doi.org/10.1186/s40359-019-0327-7 .

Snowdon DA, Sargent M, Williams CM, Maloney S, Caspers K, Taylor NF. Effective clinical supervision of allied health professionals: a mixed methods study. BMC Health Serv Res. 2020;20(1):1–11. https://doi.org/10.1186/s12913-019-4873-8 .

Borders LD. Dyadic, triadic, and group models of peer supervision/consultation: what are their components, and is there evidence of their effectiveness? Clin Psychol. 2012;16(2):59–71.

Health Service Executive. Guidance document on peer group clinical supervision. Mayo: Nursing and Midwifery Planning and Development Unit Health Service Executive West Mid West; 2023.

Sharma A, Minh Duc NT, Lam Thang L, Nam T, Ng NH, Abbas SJ, Huy KS, Marušić NT, Paul A, Kwok CL. Karamouzian, M. A consensus-based checklist for reporting of survey studies (CROSS). J Gen Intern Med. 2021;36(10):3179–87. https://doi.org/10.1007/s11606-021-06737-1 .

Article   PubMed   PubMed Central   Google Scholar  

O’Brien BC, Harris IB, Beckman TJ, Reed DA, Cook DA. Standards for reporting qualitative research: a synthesis of recommendations. Acad Med. 2014;899:1245–51. https://doi.org/10.1097/ACM.0000000000000388 .

Winstanley J, White E. The MCSS-26©: revision of the Manchester Clinical Supervision Scale© using the Rasch Measurement Model. J Nurs Meas. 2011;193(2011):160–78. https://doi.org/10.1891/1061-3749.19.3.160 .

Colorafi KJ, Evans B. Qualitative descriptive methods in health science research. HERD-Health Env Res. 2016;9:16–25. https://doi.org/10.1177/1937586715614171 .

Agnew T, Vaught CC, Getz HG, Fortune J. Peer group clinical supervision program fosters confidence and professionalism. Prof Sch Couns. 2000;4(1):6–12.

Mc Carthy V, Goodwin J, Saab MM, Kilty C, Meehan E, Connaire S, O’Donovan A. Nurses and midwives’ experiences with peer-group clinical supervision intervention: a pilot study. J Nurs Manage. 2021;29:2523–33. https://doi.org/10.1111/jonm.13404 .

Rothwell C, Kehoe A, Farook SF, Illing J. Enablers and barriers to effective clinical supervision in the workplace: a rapid evidence review. BMJ Open. 2021;119:e052929. https://doi.org/10.1136/bmjopen-2021-052929 .

Francis A, Bulman C. In what ways might group clinical supervision affect the development of resilience in hospice nurses. Int J Palliat Nurs. 2019;25:387–96. https://doi.org/10.12968/ijpn.2019.25.8.387 .

Chircop Coleiro A, Creaner M, Timulak L. The good, the bad, and the less than ideal in clinical supervision: a qualitative meta-analysis of supervisee experiences. Couns Psychol Quart. 2023;36(2):189–210. https://doi.org/10.1080/09515070.2021.2023098 .

Stacey G, Cook G, Aubeeluck A, Stranks B, Long L, Krepa M, Lucre K. The implementation of resilience based clinical supervision to support transition to practice in newly qualified healthcare professionals. Nurs Educ Today. 2020;94:104564. https://doi.org/10.1016/j.nedt.2020.104564 .

Feerick A, Doyle L, Keogh B. Forensic mental health nurses’ perceptions of clinical supervision: a qualitative descriptive study. Issues Ment Health Nurs. 2021;42:682–9. https://doi.org/10.1080/01612840.2020.1843095 .

Corey G, Haynes RH, Moulton P, Muratori M. Clinical supervision in the helping professions: a practical guide. Alexandria, VA: American Counseling Association; 2021.

Sturman N, Parker M, Jorm C. Clinical supervision in general practice training: the interweaving of supervisor, trainee and patient entrustment with clinical oversight, patient safety and trainee learning. Adv Health Sci Educ. 2021;26:297–311. https://doi.org/10.1007/s10459-020-09986-7 .

Alfonsson S, Parling T, Spännargård Å, Andersson G, Lundgren T. The effects of clinical supervision on supervisees and patients in cognitive behavioral therapy: a systematic review. Cogn Behav Therapy. 2018;47(3):206–28. https://doi.org/10.1080/16506073.2017.1369559 .

Coelho M, Esteves I, Mota M, Pestana-Santos M, Santos MR, Pires R. Clinical supervision of the nurse in the community to promote quality of care provided by the caregiver: scoping review protocol. Millenium J Educ Technol Health. 2022;2:83–9. https://doi.org/10.29352/mill0218.26656 .

Toros K, Falch-Eriksen A. Structured peer group supervision: systematic case reflection for constructing new perspectives and solutions. Int Soc Work. 2022;65:1160–5. https://doi.org/10.1177/0020872820969774 .

Bifarin O, Stonehouse D. Clinical supervision: an important part of every nurse’s practice. Brit J Nurs. 2017;26(6):331–5. https://doi.org/10.12968/bjon.2017.26.6.331 .

Turner J, Simbani N, Doody O, Wagstaff C, McCarthy-Grunwald S. Clinical supervision in difficult times and at all times. Ment Health Nurs. 2022;42(1):10–3.

Martin P, Tian E, Kumar S, Lizarondo L. A rapid review of the impact of COVID-19 on clinical supervision practices of healthcare workers and students in healthcare settings. J Adv Nurs. 2022;78:3531–9. https://doi.org/10.1111/jan.15360 .

van Dam M, van Hamersvelt H, Schoonhoven L, Hoff RG, Cate OT, Marije P. Hennus. Clinical supervision under pressure: a qualitative study amongst health care professionals working on the ICU during COVID-19. Med Edu Online. 2023;28:1. https://doi.org/10.1080/10872981.2023.2231614 .

Martin P, Lizarondo L, Kumar S, Snowdon D. Impact of clinical supervision on healthcare organisational outcomes: a mixed methods systematic review. PLoS ONE. 2021;1611:e0260156. https://doi.org/10.1371/journal.pone.0260156 .

Article   CAS   Google Scholar  

Hussein R, Salamonson Y, Hu W, Everett B. Clinical supervision and ward orientation predict new graduate nurses’ intention to work in critical care: findings from a prospective observational study. Aust Crit Care. 2019;325:397–402. https://doi.org/10.1016/j.aucc.2018.09.003 .

Love B, Sidebotham M, Fenwick J, Harvey S, Fairbrother G. Unscrambling what’s in your head: a mixed method evaluation of clinical supervision for midwives. Women Birth. 2017;30:271–81. https://doi.org/10.1016/j.wombi.2016.11.002 .

Berry S, Robertson N. Burnout within forensic psychiatric nursing: its relationship with ward environment and effective clinical supervision? J Psychiatr Ment Health Nurs. 2019;26:7–8. https://doi.org/10.1111/jpm.12538 .

Markey K, Murphy L, O’Donnell C, Turner J, Doody O. Clinical supervision: a panacea for missed care. J Nurs Manage. 2020;28:2113–7. https://doi.org/10.1111/jonm.13001 .

Brody AA, Edelman L, Siegel EO, Foster V, Bailey DE Jr., Bryant AL, Bond SM. Evaluation of a peer mentoring program for early career gerontological nursing faculty and its potential for application to other fields in nursing and health sciences. Nurs Outlook. 2016;64(4):332–8. https://doi.org/10.1016/j.outlook.2016.03.004 .

Bulman C, Forde-Johnson C, Griffiths A, Hallworth S, Kerry A, Khan S, Mills K, Sharp P. The development of peer reflective supervision amongst nurse educator colleagues: an action research project. Nurs Educ Today. 2016;45:148–55. https://doi.org/10.1016/j.nedt.2016.07.010 .

Pack M. Unsticking the stuckness’: a qualitative study of the clinical supervisory needs of early-career health social workers. Brit J Soc Work. 2015;45:1821–36. https://doi.org/10.1093/bjsw/bcu069 .

Bayliss J. Clinical supervision for palliative care. London: Quay Books; 2006.

Kenny A, Allenby A. Implementing clinical supervision for Australian rural nurses. Nurs Educ Pract. 2013;13(3):165–9. https://doi.org/10.1016/j.nepr.2012.08.009 .

MacLaren J, Stenhouse R, Ritchie D. Mental health nurses’ experiences of managing work-related emotions through supervision. J Adv Nurs. 2016;72:2423–34. https://doi.org/10.1111/jan.12995 .

Wilson HM, Davies JS, Weatherhead S. Trainee therapists’ experiences of supervision during training: a meta-synthesis. Clinl Psychol Psychother. 2016;23:340–51. https://doi.org/10.1002/cpp.1957 .

Noelker LS, Ejaz FK, Menne HL, Bagaka’s JG. Factors affecting frontline workers’ satisfaction with supervision. J Aging Health. 2009;21(1):85–101. https://doi.org/10.1177/0898264308328641 .

Download references

Acknowledgements

The research team would like to thank all participants for their collaboration, the HSE steering group members and Carmel Hoey, NMPDU Director, HSE West Mid West, Dr Patrick Glackin, NMPD Area Director, HSE West, Annette Cuddy, Director, Centre of Nurse and Midwifery Education Mayo/Roscommon; Ms Ruth Hoban, Assistant Director of Nursing and Midwifery (Prescribing), HSE West; Ms Annette Connolly, NMPD Officer, NMPDU HSE West Mid West.

The authors declare that there are no sources of funding associated with this paper.

Author information

Authors and affiliations.

Department of Nursing and Midwifery, Health Research Institute, University of Limerick, Limerick, Ireland

Owen Doody, Kathleen Markey, Claire O. Donnell & Louise Murphy

Department of Nursing and Midwifery, Sheffield Hallam University, Sheffield, UK

James Turner

You can also search for this author in PubMed   Google Scholar

Contributions

OD: Conceptualization, Methodology, Formal analysis, Investigation, Writing - Original Draft, Writing - Review & Editing, Project administration, Funding acquisition. COD: Methodology, Formal analysis, Investigation, Writing - Original Draft, Writing - Review & Editing, Funding acquisition. KM: Methodology, Formal analysis, Investigation, Writing - Original Draft, Writing - Review & Editing, Funding acquisition. JT: Methodology, Formal analysis, Writing - Original Draft, Writing - Review & Editing. LM: Methodology, Formal analysis, Investigation, Writing - Original Draft, Writing - Review & Editing, Funding acquisition.

Corresponding author

Correspondence to Owen Doody .

Ethics declarations

Ethics approval and consent to participate.

This study was approved by two health service institutional review boards University Hospital Limerick (Ref: 091/19) and Galway University Hospitals (Ref: C.A. 2199). The study was conducted in accordance with the principles of the Declaration of Helsinki and all study details were fully disclosed to participants, who were assured of the voluntary nature of participation and withdrawal. The study questionnaires were coded, and identities were not disclosed to guarantee participants’ anonymity and all participants provided written informed consent before interviews.

Consent for publication

No identifying images or other personal or clinical details of participants are presented in this paper that would compromise anonymity and all participants were aware and informed through the Participant Information Leaflet that the data collected may be reported through article and/or conference publications and this was reiterated during the qualitative data collection stage.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary material 2, supplementary material 3, rights and permissions.

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/ .

Reprints and permissions

About this article

Cite this article.

Doody, O., Markey, K., Turner, J. et al. Clinical supervisor’s experiences of peer group clinical supervision during COVID-19: a mixed methods study. BMC Nurs 23 , 612 (2024). https://doi.org/10.1186/s12912-024-02283-3

Download citation

Received : 04 January 2024

Accepted : 22 August 2024

Published : 02 September 2024

DOI : https://doi.org/10.1186/s12912-024-02283-3

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Clinical supervision

BMC Nursing

ISSN: 1472-6955

• General enquiries: [email protected]

• Open access
• Published: 31 August 2024

AC099850.3 promotes HBV-HCC cell proliferation and invasion through regulating CD276: a novel strategy for sorafenib and immune checkpoint combination therapy

• Aoxiao He 1   na1 ,
• Zhihao Huang 1   na1 ,
• Qian Feng 2 ,
• Shan Zhang 3 ,
• Hongcheng Lu 1 &
• Jiakun Wang 1  

Journal of Translational Medicine volume  22 , Article number:  809 ( 2024 ) Cite this article

Metrics details

This study investigates the molecular mechanisms of CC@AC&SF@PP NPs loaded with AC099850.3 siRNA and sorafenib (SF) for improving hepatitis B virus-related hepatocellular carcinoma (HBV-HCC).

A dataset of 44 HBV-HCC patients and their survival information was selected from the TCGA database. Immune genes related to survival status were identified using the ImmPort database and WGCNA analysis. A prognostic risk model was constructed and analyzed using Lasso regression. Differential analysis was performed to screen key genes, and their significance and predictive accuracy for HBV-HCC were validated using Kaplan–Meier survival curves, ROC analysis, CIBERSORT analysis, and correlation analysis. The correlation between AC099850.3 and the gene expression matrix was calculated, followed by GO and KEGG enrichment analysis using AC099850.3 and its co-expressed genes. HepG2.2.15 cells were selected for in vitro validation, and lentivirus interference, cell cycle determination, CCK-8 experiments, colony formation assays, Transwell experiments, scratch experiments, and flow cytometry were performed to investigate the effects of key genes on HepG2.2.15 cells. A subcutaneous transplanted tumor model in mice was constructed to verify the inhibitory effect of key genes on HBV-HCC tumors. Subsequently, pH-triggered drug release NPs (CC@AC&SF@PP) were prepared, and their therapeutic effects on HBV-HCC in situ tumor mice were studied.

A prognostic risk model (AC012313.9, MIR210HG, AC099850.3, AL645933.2, C6orf223, GDF10) was constructed through bioinformatics analysis, showing good sensitivity and specificity in diagnostic prediction. AC099850.3 was identified as a key gene, and enrichment analysis revealed its impact on cell cycle pathways. In vitro cell experiments demonstrated that AC099850.3 promotes HepG2.2.15 cell proliferation and invasion by regulating immune checkpoint CD276 expression and cell cycle progression. In vivo, subcutaneously transplanted tumor experiments showed that AC099850.3 promotes the growth of HBV-HCC tumors in nude mice. Furthermore, pH-triggered drug release NPs (CC@AC&SF@PP) loaded with AC099850.3 siRNA and SF were successfully prepared and delivered to the in situ HBV-HCC, enhancing the effectiveness of combined therapy for HBV-HCC.

Conclusions

AC099850.3 accelerates the cell cycle progression and promotes the occurrence and development of HBV-HCC by upregulating immune checkpoint CD276 expression. CC@AC&SF@PP NPs loaded with AC099850.3 siRNA and SF improve the effectiveness of combined therapy for HBV-HCC.

Introduction

Hepatitis B virus-related hepatocellular carcinoma (HBV-HCC) is a serious disease that poses a significant threat to human health, with a high incidence and mortality rate worldwide [ 1 , 2 ]. Although there are currently some treatment methods available for managing HBV-HCC, their effectiveness remains suboptimal [ 3 ]. Therefore, further research on the molecular mechanisms of HBV-HCC and the development of new treatment strategies are needed to improve therapeutic outcomes.

The long non-coding RNA (lncRNA) AC099850.3 has attracted widespread attention in cancer research in recent years. AC099850.3 is involved in multiple biological processes such as cell proliferation, apoptosis, migration, and invasion by regulating the expression of target genes. Studies have shown that AC099850.3 exhibits abnormal expression in various cancers, particularly in lung cancer [ 4 , 5 ]. High expression of AC099850.3 is associated with the aggressiveness of tumors and poor prognosis. For instance, AC099850.3 promotes cancer cell proliferation and migration by competitively binding to miRNA, thereby relieving its inhibitory effect on target genes. Therefore, AC099850.3 is considered a potential therapeutic target, and its role in cancer has become a research focus.

CD276, also known as B7-H3, is a type I transmembrane protein that belongs to the B7 family of immune regulatory molecules. Functioning as an immune checkpoint molecule, CD276 plays a crucial role in immune evasion and the tumor immune microenvironment. By binding to its receptors, CD276 inhibits the activation and proliferation of T cells, thereby suppressing the immune system's recognition and killing ability against tumor cells [ 6 ]. High expression of CD276 is associated with poor prognosis and increased tumor invasiveness in various cancers [ 7 , 8 ]. Consequently, immunotherapeutic strategies targeting CD276, such as anti-CD276 antibodies and CD276-directed CAR-T cell therapy, have emerged as important directions in cancer research.

As a novel treatment strategy, nanomedicine delivery systems have shown tremendous potential in cancer treatment [ 9 , 10 , 11 , 12 ]. This system utilizes NPs as carriers to deliver drugs, enhancing their targeting specificity in tumor tissue and reducing side effects in non-tumor tissue [ 9 , 13 , 14 , 15 ]. The constrained and deactivated model (AC&SF) NPs represent a novel nanomedicine delivery carrier with biocompatibility and good in vitro regenerative properties.

In the treatment of HBV-HCC, AC099850.3 is considered an important regulatory factor playing a crucial role in the cell cycle progression [ 16 , 17 , 18 ]. Recent studies have revealed that AC099850.3 promotes the occurrence and development of HBV-HCC by regulating the expression of immune checkpoint CD276 and facilitating cell cycle progression [ 19 ]. In order to gain a deeper understanding of the functions and potential therapeutic value of AC099850.3, further research is required to investigate its mechanism of action in HBV-HCC [ 5 , 20 ].

Sorafenib (SF) is the first drug approved by the Food and Drug Administration (FDA) for the treatment of advanced HCC and remains one of the most commonly used drugs in systemic therapy for hepatocellular carcinoma. It is an effective targeted chemotherapy drug that can inhibit angiogenesis, proliferation, and invasion [ 21 , 22 ]. However, due to its poor solubility and potential for various adverse reactions such as hypertension, diarrhea, hand-foot syndrome, and rash/desquamation, the use of SF as a monotherapy is significantly restricted in clinical applications [ 23 , 24 , 25 ]. Therefore, there is an urgent need to develop new treatment strategies.

The occurrence and metastasis of HCC involve a complex process characterized by multiple genes, factors, and steps [ 26 ]. Gene therapy holds promise for achieving positive treatment outcomes. Moreover, an increasing body of evidence supports the synergistic therapeutic effect of combining gene therapy with chemotherapy for HCC [ 27 , 28 ]. The combination therapy of PD-1 or PD-L1 with SF has demonstrated significant synergistic therapeutic effects in treating HCC [ 29 , 30 ], making it a promising and potent therapeutic approach.

The objective of this study was to investigate the effectiveness of AC099850.3 siRNA and SF in combination therapy for HBV-HCC and elucidate its molecular mechanisms. We hypothesize that AC099850.3 may promote tumor proliferation and invasion by upregulating CD276, thus driving the progression of HBV-HCC. Furthermore, we propose that combining siRNA targeting AC099850.3 with SF may offer a novel therapeutic strategy for the treatment of HBV-HCC. Initially, we screened a dataset and survival information of HBV-HCC patients from the TCGA database. Through analysis using the ImmPort database and WGCNA, we identified immune gene modules associated with the survival status of HBV-HCC [ 31 , 32 , 33 ]. Subsequently, we employed differential analysis to further identify key genes related to HBV-HCC [ 34 ]. In vitro experiments and a subcutaneous transplanted tumor model in mice were then used to study the role of AC099850.3 in HBV-HCC cell proliferation and invasion, as well as assess its impact on tumor growth [ 4 , 35 , 36 ].

The significance of this study lies in gaining a deeper understanding of the mechanisms by which AC099850.3 functions in the occurrence and progression of HBV-HCC, providing new targets and strategies for its treatment. Moreover, we prepared pH-triggered drug-delivery NPs (CC@AC&SF@PP) and studied their therapeutic effects on HBV-HCC tumors. We believe that the results of this research will offer new insights and approaches for the clinical treatment of HBV-HCC, serving as a reference for further studies and translational applications in this field.

Prognostic model based on immune-related genes demonstrates good diagnostic predictive value in HBV-HCC

Firstly, we obtained liver cancer RNA-Seq (TCGA-LIHC) data from the TCGA database. Based on the characteristic of HBV positivity in clinical data of LIHC patients, we extracted HBV-HCC RNA-Seq data comprising 50 normal samples and 44 tumor samples. The genes in the expression matrix were categorized into mRNA (19,574 genes) and lncRNA (14,056 genes), and their expression matrix, survival information, and clinical information were merged. Clustering of all samples and selection of the optimal soft threshold was performed to construct gene modules based on the merged mRNA matrix (Figure S1A-B), resulting in the construction of the WGCNA co-expression network. Through the co-expression network, all genes were divided into seven different gene modules (Figure S1C), and heat map results of dynamic splice variation analysis were obtained, showing correlations with patient survival time, survival status, age, gender, grading, and staging (Fig.  1 A). The MEbrown module, with the highest correlation with survival status, was selected for further analysis. This module consisted of 174 genes (Table S1), with a correlation of r = 0.31 (P = 0.04) to HBV-HCC. Subsequently, we downloaded immune-related gene sets from the ImmPort database (Table S2) and extracted immune-related mRNAs from the MEbrown module. In addition, we screened lncRNAs that were correlated with immune-related mRNAs in the MEbrown module (Table S3).

Construction and validation of the HBV-HCC prognostic model. A Heatmap depicting the correlation between gene modules and patient survival time, survival status, age, gender, grade, and stage; B Results of LASSO analysis, where the x-axis represents log(λ) values, the y-axis represents Partial Likelihood Deviance, the top portion represents the number of genes retained for a corresponding log(λ) value used in the calculation, the dashed line represents the log(λ) value and number of retained genes at the optimal Partial Likelihood Deviance; C Differential expression levels of the six model genes between high and low-risk groups; D Risk score evaluation using univariate Cox regression analysis; E Risk score evaluation using multivariate Cox regression analysis, with Hazard ratio indicating the risk rate, a Hazard ratio greater than 1 signifies high risk, while a Hazard ratio less than 1 signifies low risk; F Kaplan–Meier survival curves for the high and low-risk groups; G ROC curve analysis indicating the predictive value of the high and low-risk groups in HBV-HCC diagnosis; H Risk curves and patient survival status graphs for the high and low-risk groups; I Heatmap displaying the expression levels of the six model genes in the high and low-risk groups; high-risk group: 23 samples; low-risk group: 21 samples; * denotes comparison between high and low-risk groups, P < 0.05; ** denotes comparison between high and low-risk groups, P < 0.01; *** denotes comparison between high and low-risk groups, P < 0.001

Next, we performed a single-variable Cox regression analysis using the “survival” package to screen for immune-related mRNAs (22 genes) and lncRNAs (36 genes) associated with prognosis (Table S4). LASSO analysis was then conducted to draw Lasso regression coefficient plots and cross-validation plots (Fig.  1 B, Figure S1D), further narrowing down the candidate gene list to select six model genes with the best lambda values: AC012313.9, MIR210HG, AC099850.3, AL645933.2, C6orf223, and GDF10. Patients were divided into low-risk and high-risk subgroups based on the median risk score, and the differential expression of the six model genes between the high and low-risk groups was demonstrated, showing significant differences for all six model genes (Fig.  1 C). Univariate and multivariate Cox regression analyses were conducted to assess whether the risk score could serve as an independent prognostic factor. The results showed that the risk score was significantly associated with overall survival (OS) and could be an independent prognostic factor (Fig.  1 D, E ). KM survival analysis was performed on randomized subsets of the dataset (train), test subsets (test), and the entire dataset (all), demonstrating that low-risk HBV-HCC had a significantly better prognosis than high-risk HBV-HCC (P < 0.001, P = 0.031, and P < 0.001) (Fig.  1 F, Figure S1E-F). ROC curve analysis showed that the model had a high diagnostic predictive value for HBV-HCC (AUC = 0.873, 0.729, 0.984) (Fig.  1 G, Figure S2A-B). Setting the median risk score as the threshold and plotting the survival status graph demonstrated that the majority of high-risk HBV-HCC patients died, further proving the stability of the model (Fig.  1 H, Figure S2C, E). Heat maps showed the expression patterns of the six model genes in low-risk and high-risk HBV-HCC, and consistent trends were observed in the train and test subsets (F i g.  1 I, Figure S2D, F).

In conclusion, the prognostic model constructed based on immune-related genes (AC012313.9, MIR210HG, AC850.3, AL645933.2, C6orf223, GDF10) demonstrated good sensitivity and specificity, with high diagnostic predictive value for HBV-HCC.

AC099850.3 is a key gene in HBV-HCC and plays an important role in tumor immunotherapy

In order to further identify key genes in HBV-HCC, we conducted differential analysis on 50 normal samples and 44 tumor samples (Fig.  2 A, B ). We found significant differences in the genes MIR210HG (logFC = 0.33), AC099850.3 (logFC = 1.33), AL645933.2 (logFC = 0.06), and C6orf223 (logFC = 0.78), while AC012313.9 and GDF10 showed no differences (Fig.  2 C, Figure S3A-E). We selected AC099850.3, which had the highest expression level, as the key gene for further investigation in HBV-HCC. Additionally, there was a significant difference in AC099850.3 expression in paired samples (Fig.  2 D). Following this, we divided the 44 tumor samples into high and low-expression groups based on the median expression level of AC099850.3 and performed KM survival analysis, which revealed that the prognosis of HBV-HCC in the low-expression group was significantly better than that in the high-risk group (P = 0.007) (Fig.  2 E). ROC curve analysis showed that the AUC for 1-year, 3-year, and 5-year survival was 0.836, 0.847, and 0.826, respectively, indicating the stable predictive ability of AC099850.3 (Fig.  2 F).

Screening and validation of key genes in HBV-HCC. A , B Volcano plot and heatmap of differentially expressed genes between 50 normal samples and 44 HBV-HCC samples from the TCGA database (red dots represent upregulated genes, green dots represent downregulated genes, black dots represent genes with no significant difference in expression between the two groups); C Differential expression level of AC099850.3 gene between 50 normal samples and 44 HBV-HCC samples; D Differential expression level of AC099850.3 gene between 8 HBV-HCC samples and their paired normal samples in the TCGA database; E Kaplan–Meier survival curve of AC099850.3 high and low expression groups; F ROC curve analysis of the predictive value of the AC099850.3 high and low expression groups in HBV-HCC diagnosis; G Analysis of the differences in immune cell composition between AC099850.3 high and low expression groups, where the x-axis represents immune cell types and the y-axis represents the proportion of immune cells in the samples, with blue representing the low expression group of AC099850.3 and red representing the high expression group of AC099850.3; H Lollipop plot illustrating the correlation between significantly different immune cell components and AC099850.3 expression levels; I Heatmap showing the correlation between AC099850.3 and immune checkpoints; * denotes comparison between the two groups, P < 0.05; ** denotes comparison between the two groups, P < 0.01; *** denotes comparison between the two groups, P < 0.001

By using the CIBERSORT algorithm to analyze the differential composition of immune cells in HBV-HCC patient samples, we found significant differences in the immune cell components CD8 T cells and follicular helper T cells (Fig.  2 G). Furthermore, correlation analysis between all immune cell components and AC099850.3 expression revealed significant correlations between inactive dendritic cells (R = 0.37, P = 0.033), follicular helper T cells (R = 0.58, P < 0.001), and T cells γδ (R = -0.36, P = 0.042) and the expression of AC099850.3 (Fig.  2 H, Figure S3F-H). In addition, we investigated the correlation between AC099850.3 and immune checkpoints and found significant correlations with CD200R1 (R = 0.52, P < 0.001) and CD276 (R = 0.53, P < 0.001) (F i g.  2 I). The study on the correlation between AC099850.3 and tumor mutation burden showed a positive correlation between AC099850.3 expression and tumor mutation burden (R = 0.34, P = 0.026) (Figure S3I).

These results indicate that AC099850.3 is a key gene in HBV-HCC, which plays an important role in tumor immunotherapy by influencing immune cell infiltration and the expression of immune checkpoint factors.

Regulation of nuclear division and cell cycle by AC099850.3 and its co-expressed genes in HBV-HCC

To explore the function of AC099850.3 in HBV-HCC, we selected 727 HBV-HCC genes that were co-expressed with AC099850.3, using a correlation threshold of greater than 0.7 and P < 0.001 (Table S5). The circle plot and correlation scatter plot depicted the top-ranking genes correlated with AC099850.3 (Fig.  3 A and Figure S4). We performed GO functional analysis and KEGG pathway analysis on AC099850.3 and its co-expressed genes.

Functional enrichment analysis of AC099850.3 and its co-expressed genes. A Circos plot displaying the top-ranked genes correlated with AC099850.3; B , C Circos plot and bubble plot, illustrating the GO functional analysis of AC099850.3 and its co-expressed genes at the BP, CC, and MF levels; D Bubble plot depicting the KEGG pathway enrichment analysis of AC099850.3 and its co-expressed genes, where the size of the dots represents the number of selected genes and the color represents the P-value of the enrichment analysis

GO functional analysis revealed that AC099850.3 and its co-expressed genes were primarily enriched in BP, such as mitotic nuclear division, positive regulation of cell cycle, chromosome segregation, DNA-templated DNA replication, and mitotic sister chromatid segregation. In terms of CC, the enrichment was observed in microtubules, chromosomal regions, nuclear chromosomes, condensed chromosomes, and centromeric regions. Moreover, in MF, enrichment was observed in ATP hydrolysis activity, catalytic activity acting on DNA, helicase activity, microtubule motor activity, and single-stranded DNA binding (Fig.  3 B, C ). KEGG pathway analysis revealed that AC099850.3 and its co-expressed genes were mainly enriched in Motor proteins and Cell cycle pathways (Fig.  3 D).

These functional enrichment results suggest that AC099850.3 and its co-expressed genes are primarily involved in the positive regulation of nuclear division and the cell cycle and chromosome separation and are enriched in structures such as microtubules, chromosomal regions, and centromeres. In terms of molecular functions, they are mainly involved in ATP hydrolysis activity, helicase activity, and microtubule motor activity. According to KEGG analysis, AC099850.3 and its co-expressed genes are enriched in the cell cycle pathway (ID: hsa04110, P < 0.001). Previous studies have demonstrated that genes related to cell cycle regulation may be associated with tumor occurrence, development, and metastasis [ 37 ]. Additionally, the literature suggests a close association between LncRNA AC099850.3 and proliferation and invasion of HCC and its correlation with patient prognosis [ 20 ], which is consistent with our findings.

Based on the above results, we speculate that AC099850.3 promotes tumor cell proliferation and invasion in HBV-HCC by influencing the cell cycle, thus participating in the occurrence and development of this cancer.

AC099850.3 regulates cell cycle progression and proliferation and invasion of HepG2.2.15 cells through modulation of CD276

Immunotherapy has emerged as a primary approach for cancer treatment. In investigating the proliferative effects of immune checkpoints in different tumors, the role of CD276 (B7-H3) in regulating cell cycle and tumor proliferation has been identified [ 38 , 39 ]. Through bioinformatics analysis, a positive correlation between AC099850.3 and immune checkpoint CD276 was observed (F i g.  2 I). Therefore, we hypothesized that AC099850.3 may influence cell cycle progression and promote the proliferation and invasion of HepG2.2.15 cells by modulating the expression of immune checkpoint CD276.

To validate our hypothesis, we transfected HepG2.2.15 cells with si-NC, si-AC099850.3, si-CD276 and confirmed transfection efficiency via qRT-PCR. We proceeded with subsequent experiments using the group exhibiting the most effective silencing efficiency (Fig.  4 A). In the cell cycle experiment conducted after 48 h (Fig.  4 B), the proportion of HepG2.2.15 cells in the G2/M phase increased significantly in the si-AC099850.3 and si-CD276 group, indicating a G2/M phase cell cycle arrest compared to the si-NC group. Furthermore, compared to the si-AC099850.3 + oe-NC group, the si-AC099850.3 + oe-CD276 group showed a decrease in the proportion of HepG2.2.15 cells in the G2/M phase, alleviating the G2/M phase cell cycle arrest.

Impact of AC099850.3/CD276 expression on HepG2.2.15 cells. A qRT-PCR assessing the transfection efficiency of three AC099850.3 siRNAs and three CD276 siRNAs in HepG2.2.15 cells; B Flow cytometry determining the cell cycle and presenting a bar graph of cell proportions in different phases of the cell cycle; C , D CCK-8 assay and colony formation assay evaluating the proliferation ability of the different cell groups; E Flow cytometry measuring the apoptosis of the different cell groups; F , G Scratch assay (Scale bar: 100 μm) and Transwell assay (Scale bar: 50 μm) examining the migration and invasion capabilities of the different cell groups; H Western blot analysis assessing the expression levels of CD276, E-cadherin, N-cadherin, and Vimentin in HepG2.2.15 cells; * denotes comparison with the si-NC group, P < 0.05; ** denotes comparison with the si-NC group, P < 0.01; *** denotes comparison with the si-NC group, P < 0.001; # denotes comparison with the si-AC099850.3 + oe-NC group, P < 0.05; ## denotes comparison with the si-AC099850.3 + oe-NC group, P < 0.01; ### denotes comparison with the si-AC099850.3 + oe-NC group, P < 0.001; all cell experiments were repeated three times

Cell proliferation ability was assessed using CCK-8 and colony formation assay, and the results showed (Fig.  4 C, D ) a significant reduction in the proliferation ability of HepG2.2.15 cells in the si-AC099850.3 and si-CD276 group when compared to the si-NC group. In contrast, the si-AC099850.3 + oe-CD276 group exhibited a significant enhancement in cell proliferation ability compared to the si-AC099850.3 + oe-NC group. Flow cytometry analysis of cell apoptosis (Fig.  4 E) revealed increased apoptosis in HepG2.2.15 cells in the si-AC099850.3 and si-CD276 groups compared to the si-NC group. Conversely, the si-AC099850.3 + oe-CD276 group demonstrated a reduction in apoptosis compared to the si-AC099850.3 + oe-NC group.

Sc scratch experiments and Transwell assays were performed to evaluate cell migration and invasion abilities. The results indicated (Fig.  4 F, G ) a significant decrease in the migration and invasion abilities of HepG2.2.15 cells in the si-AC099850.3 and si-CD276 group compared to the si-NC group. Conversely, the si-AC099850.3 + oe-CD276 group exhibited a significant enhancement in cell migration and invasion abilities compared to the si-AC099850.3 + oe-NC group. Furthermore, Western blot analysis demonstrated (Fig.  4 H) a significant increase in E-cadherin protein levels and a significant decrease in CD276, N-cadherin, and Vimentin protein levels in HepG2.2.15 cells in the si-AC099850.3 and si-CD276 group compared to the si-NC group. Conversely, the si-AC099850.3 + oe-CD276 group showed a significant decrease in E-cadherin protein levels and a significant increase in CD276, N-cadherin, and Vimentin protein levels when compared to the si-AC099850.3 + oe-NC group.

In summary, AC099850.3 affects cell cycle progression and promotes the proliferation and invasion abilities of HepG2.2.15 cells by regulating the expression of immune checkpoint CD276.

Knocking down of AC099850.3 inhibits tumor growth in HBV-HCC bearing nude mice

To investigate the impact of AC099850.3/CD276 on HBV-HCC growth in nude mice, we established an HBV-HCC nude mouse model and injected si-NC, si-AC099850.3, si-AC099850.3 + oe-NC, or si-AC099850.3 + oe-CD276 HepG2.2.15 cells. After euthanizing the mice three weeks later, tumor tissue was removed and weighed. The results revealed (Fig.  5 A) a significant reduction in tumor weight and volume in the si-AC099850.3 group compared to the si-NC group. Additionally, compared to the si-AC099850.3 + oe-NC group, the si-AC099850.3 + oe-CD276 group exhibited a significant increase in tumor weight and volume. qRT-PCR and Western blot analysis results (Fig.  5 B, C ) showed a significant decrease in AC099850.3 and CD276 mRNA and protein levels in tumor tissue of the si-AC099850.3 group compared to the si-NC group. Conversely, compared to the si-AC099850.3 + oe-NC group, the si-AC099850.3 + oe-CD276 group displayed a significant increase in CD276 mRNA and protein levels in tumor tissue. Furthermore, results from HE staining and TUNEL staining (Fig.  5 D) demonstrated that tumor tissue cells in the si-AC099850.3 group exhibited necrosis and apoptosis compared to the si-NC group, while the si-AC099850.3 + oe-CD276 group showed reduced levels of necrosis and apoptosis compared to the si-AC099850.3 + oe-NC group. Western blot analysis was used to evaluate the expression of proliferation-related proteins (Ki-67 and PCNA) (Fig.  5 E), showing a decrease in Ki-67 and PCNA expression levels in tumor tissue of the si-AC099850.3 group compared to the si-NC group. On the other hand, the si-AC099850.3 + oe-CD276 group displayed an upregulation of Ki-67 and PCNA expression levels in tumor tissue compared to the si-AC099850.3 + oe-NC group.

Impact of AC099850.3/CD276 expression on HepG2.2.15 cells. A Tumor images, as well as statistics of tumor weight and volume in the subcutaneous tumors of each group of nude mice; B , C RT-qPCR and Western blot analysis assessing the expression levels of AC099850.3 and CD276; D HE staining to detect cell necrosis in tumor tissue, TUNEL staining to detect cell apoptosis in tumor tissue (Scale bar: 100 μm); E Western blot analysis measuring the expression levels of proliferation-related proteins (Ki-67 and PCNA) in tumor tissue; *** denotes comparison with the si-NC group, P < 0.001; ## denotes comparison with the si-AC099850.3 + oe-NC group, P < 0.01; ### denotes comparison with the si-AC099850.3 + oe-NC group, P < 0.001; N = 5

In conclusion, the low expression of AC099850.3 inhibits tumor growth, leading to an increase in apoptotic cells in tumor tissue, while overexpression of CD276 can reverse the effect of low expression of AC099850.3 in nude mice.

Preparation, characterization, and drug release of CC@AC&SF@PP NPs nanocarriers

In this study, we discovered that AC099850.3 affects cell cycle progression by regulating the immune checkpoint CD276, promoting proliferation and invasion of HBV-HCC tumor cells. Hence, we prepared pH-triggered drug-eluting NPs called CC@AC&SF@PP NPs (Fig.  6 A), which were designed to co-deliver AC099850.3 siRNA and SF to the HBV-HCC site for combination therapy. SF was encapsulated within pH-triggered positively-charged mPEG5K-PAE10K (PP) NPs using a single emulsion method, and AC099850.3 siRNA with negatively-charged was condensed on the surface of the drug-loaded NPs via electrostatic interactions. Finally, carboxymethyl chitosan (CMCS) was used to encapsulate the NPs. CMCS is negatively charged at physiological pH and positively charged in the tumor's acidic environment, allowing for targeted drug release.

Preparation, characterization, and drug release of CC@AC&SF@PP NPs. A Schematic representation of drug elution from the CC@AC&SF@PP NPs triggered by pH; B Representative TEM image of CC@AC&SF@PP (Scale bar: 100 nm); C Size distribution of CC@AC&SF@PP measured by DLS; D Zeta potential of CC@AC&SF@PP; E Ultraviolet–visible absorption spectra of PP NPs, AC099850.3 siRNA, SF@PP NPs, and CC@AC&SF@PP NPs; F In vitro SF release profile from CC@AC&SF@PP NPs in PBS buffer at pH 7.4 and 6.5; G Size of CC@AC&SF@PP on day 0 and day 30

To confirm the successful preparation of CC@AC&SF@PP NPs, we conducted comprehensive characterizations. TEM analysis showed that CC@AC&SF@PP NPs exhibited excellent dispersion and a uniform spherical appearance (Fig.  6 B). Dynamic light scattering (DLS) measurements demonstrated a hydrodynamic diameter of CC@AC&SF@PP NPs as 130 ± 1.82 nm (Fig.  6 C) and a zeta potential of − 4.1 ± 0.13 mV (Fig.  6 D). Additionally, by comparing the absorbance spectra of CC@AC&SF@PP NPs with SF@PP NPs, free AC099850.3 siRNA, and PP NPs, overlay features were observed in terms of peak height, peak area, and peak shape (Fig.  6 E). This indicates that both SF and AC099850.3 siRNA were successfully loaded onto PP NPs, with the characteristic overlapping absorbance peak of CC@AC&SF@PP NPs appearing at 271 nm. Moreover, pH-dependent drug release profiles of CC@AC&SF@PP NPs were studied by dialysis and HPLC (Fig.  6 F). The results showed that under acidic physiological conditions (PBS, pH = 6.5), CC@AC&SF@PP NPs exhibited accelerated release rates with a sustained release rate even after 72 h, reaching a release rate of 88–94% for SF. Conversely, under normal physiological conditions (PBS, pH = 7.4), the release rate of CC@AC&SF@PP NPs was relatively low, ceasing after 48 h and achieving a maximum drug release rate of less than 40%. This demonstrates the ability of CC@AC&SF@PP NPs to sustain release in the acidic tumor tissue environment, making them a potential candidate for an ideal tumor microenvironment-triggered drug delivery system. Furthermore, stability analysis results (Fig.  6 G) revealed that CC@AC&SF@PP NPs maintained high colloidal stability after 30 days of storage in sterile water without DNA/RNA.

In conclusion, we successfully prepared CC@AC&SF@PP NP nanocarriers with excellent monodispersity, sustained release properties, and stability.

Downregulation of AC099850.3 and CD276 expression by CC@AC&SF@PP inhibited the proliferation and invasion abilities of HepG2 2.2.15 cells

In this study, we investigated the cellular uptake capacity of CC@AC&SF@PP NPs in HepG2 2.2.15 cells. HepG2 2.2.15 cells were exposed to a culture medium containing Cy3-AC099850.3 siRNA or CC@AC&SF@PP NPs and incubated for 6 h at pH 7.4 or 6.5. The results (Fig.  7 A) showed strong fluorescence intensity in the groups treated with CC@AC&SF@PP NPs at pH 6.5, as well as the siRNA&Lipo2000 complex, whereas only weak fluorescence was observed in the Cy3-AC099850.3 siRNA group or the CC@AC&SF@PP NPs treated group at pH 7.4. This indicates that CC@AC&SF@PP NPs were effectively internalized by the cells. Furthermore, we investigated whether CC@AC&SF@PP NPs could reduce AC099850.3 expression and affect CD276 expression at the cellular level. The results of RT-qPCR and Western blot experiments (Fig.  7 B, C ) showed that compared to the Control group, there was no significant difference in the expression levels of AC099850.3 and CD276 in HepG2 2.2.15 cells treated with CC@PP, whereas a significant decrease in expression levels was observed in the CC@AC&SF@PP group and the siRNA&Lipo2000 group. Moreover, the expression levels of AC099850.3 and CD276 in the CC@AC&SF@PP group were lower than those in the siRNA&Lipo2000 group.

Effect of CC@AC&SF@PP NPs on HepG2.2.15 cells. A The cellular uptake capacity of CC@AC&SF@PP NPs in HepG2 2.2.15 cells at pH 6.5 and 7.4. The strong fluorescence intensity observed at pH 6.5 indicates effective internalization by the cells; B , C Expression levels of AC099850.3 and CD276 measured by RT-qPCR and Western blot; D Flow cytometry analysis of cell cycle and statistical histograms showing cell cycle phase distribution; E , F Cell proliferation measured by CCK-8 assay and colony formation experiment; G Apoptosis assay by flow cytometry; H , I Cell migration and invasion abilities evaluated by scratch assay (Scale bar: 100 μm) and Transwell assay (Scale bar: 50 μm); J Expression levels of E-cadherin, N-cadherin, and Vimentin in HepG2.2.15 cells determined by Western blot; NS represents no significant difference compared to the Control group; ** represents significant difference compared to the Control group, P < 0.01; *** represents significant difference compared to the Control group, P < 0.001; # represents significant difference compared to the AC&SF group, P < 0.05; ## represents significant difference compared to the AC&SF group, P < 0.01; all cellular experiments were repeated three times

The results of the cell cycle analysis (Fig.  7 D) showed no significant difference in the G2/M phase cell proportion of HepG2.2.15 cells between the Control group and the CC@PP group. However, a significant increase in the G2/M phase cell proportion was observed in the CC@AC&SF@PP group and the AC&SF group, indicating G2/M phase cell cycle arrest, with more pronounced arrest in the CC@AC&SF@PP group. The results of the CCK-8 assay and colony formation assay (Fig.  7 E, F ) demonstrated that the proliferation ability of HepG2.2.15 cells in the CC@PP group showed no significant difference compared to the Control group, whereas the proliferation ability of HepG2.2.15 cells was significantly compromised in the CC@AC&SF@PP group and the AC&SF group, with more significant reduction in the CC@AC&SF@PP group. Flow cytometry analysis (Fig.  7 G) revealed enhanced apoptosis in HepG2.2.15 cells in the CC@AC&SF@PP group and the AC&SF group, with a more pronounced enhancement in the CC@AC&SF@PP group. Scratch and Transwell assays (F i g.  7 H, I ) demonstrated that compared to the Control group, there was no significant difference in the migration and invasion abilities of HepG2.2.15 cells in the CC@PP group, whereas a significant decrease was observed in the CC@AC&SF@PP group and the AC&SF group, with more significant reduction in the CC@AC&SF@PP group. Furthermore, the results of Western blot analysis (Fig.  7 J) showed no significant difference in the protein levels of E-cadherin, N-cadherin, and Vimentin in HepG2.2.15 cells between the Control group and the CC@PP group, whereas there was a significant increase in the E-cadherin protein level and a significant decrease in the N-cadherin and Vimentin protein levels in the CC@AC&SF@PP group and the AC&SF group.

These results indicate that CC@AC&SF@PP NPs can be effectively internalized by HepG2 2.2.15 cells, leading to the downregulation of AC099850.3 and CD276 expression, which in turn affects cell cycle progression and promotes proliferation and invasion abilities in HepG2 2.2.15 cells.

Enhancing the delivery of siRNA and SF in tumor tissue through CC@AC&SF@PP NPs

To further investigate the delivery efficacy of CC@AC&SF@PP NPs loaded with Cy5-AC099850.3 siRNA and SF in tumor tissue, we performed an experiment as depicted in Figure S5A. Six hours after intraperitoneal injection, a noticeable fluorescence intensity was observed in the abdominal cavity, indicating the rapid clearance of free siRNA in vivo. In contrast, CC@AC&SF@PP NPs containing the same concentration of Cy5-AC099850.3 siRNA exhibited bright fluorescence solely in the liver, with even more prominent fluorescence observed at the tumor site within the liver. This indicates the stability of the NPs in vivo and their successful enhancement of siRNA delivery to the tumor region. Subsequently, we conducted ex vivo imaging of various tissues and organs in mice (Figure S5B), which further confirmed the high accumulation of NPs in the liver tumor tissue, while free siRNA was rapidly metabolized through the liver and kidneys. To demonstrate the accurate cellular delivery and release of CC@AC&SF@PP NPs in the tumor region, tumor tissue slices were obtained at the white dashed line in Figure S5B. As shown in Figure S5C, the tumor region treated with CC@AC&SF@PP NPs exhibited an enhanced Cy5 fluorescence signal, primarily distributed around the hepatic lobes, corresponding to the location of tumor growth in Figure S5B. This indicates that CC@AC&SF@PP NPs exhibit targeting and specificity, accurately releasing the drug in the slightly acidic microenvironment of tumor tissue. Conversely, due to its nonspecific nature, free siRNA displayed a uniform fluorescence distribution in the tumor slices. Additionally, in the toxicity assessment experiment of the NPs (Figure S5D), no tissue damage, necrosis, or inflammation were observed in the slices treated with CC@AC&SF@PP NPs, both in the short-term (1 day) and long-term (7 days), providing ample evidence for the excellent biocompatibility of CC@AC&SF@PP NPs in vivo.

Finally, we evaluated the in vivo anti-tumor efficacy of CC@AC&SF@PP NPs in a mouse HBV-HCC in situ tumor model. Mice were divided into PBS, CC@PP, CC@AC@PP, CC@NC&SF@PP, CC@AC&SF@PP, and AC&SF groups, administered via tail vein injection once every three days, and tumor growth was observed. The tumor size was measured by a small animal imaging system based on the intensity of bioluminescence (Fig.  8 A). Compared to the PBS group, the CC@PP group did not exhibit any inhibitory effect on tumor growth. The CC@AC@PP and CC@NC&SF@PP groups showed suboptimal inhibition of tumor growth. The AC&SF group, using a combination therapy based on free diffusion, was able to partially suppress tumor growth. However, the CC@AC&SF@PP group demonstrated a more pronounced inhibition of tumor growth. In comparison to the CC@PP group, the CC@NC&SF@PP group exhibited a moderate inhibitory effect on tumor growth. These results indicate that the synergistic enhancement of treatment effects between AC099850.3 siRNA gene therapy and SF in vivo leads to significant inhibition of tumor growth. Subsequently, tumor growth curves were obtained by measuring the bioluminescence intensity of tumor tissue (Fig.  8 B). On the 16th day after the first injection, mice were sacrificed, and the entire liver was collected. These results were consistent with the imaging system observations, with the lowest level of tumor growth observed in mice treated with CC@AC&SF@PP NPs (Fig.  8 C). Results from the RT-qPCR and Western blot experiments (Fig.  8 D, E ) indicated that the free siRNA exhibited instability and non-specific absorption in vivo, along with rapid clearance in the liver and kidneys. AC&SF only partially inhibited the expression of AC099850.3 and CD276 in vivo, whereas CC@AC&SF@PP NPs and CC@AC@PP NPs benefited from the protective effect of the CMCS shell and the pH-triggered delivery system, promoting the delivery of AC099850.3 siRNA to tumor tissue and enhancing its transfer to tumor cells, thus reducing the expression of AC099850.3 and CD276 in the tumor tissue. Additionally, immunohistochemical results (Fig.  8 F) demonstrated a significant decrease in CD276 expression levels in the AC&SF, CC@AC&SF@PP, and CC@AC@PP groups compared to the PBS and CC@PP groups, with CC@AC&SF@PP and CC@AC@PP groups showing a more significant decrease. Results from HE staining and TUNEL staining (Fig.  8 G) revealed necrosis and apoptosis of tumor tissue cells in the PBS and CC@PP groups, partial alleviation of necrosis and apoptosis in the AC&SF and CC@AC@PP groups, and a significant alleviation of necrosis and apoptosis in the CC@AC&SF@PP group.

Effects of CC@AC&SF@PP NPs on HepG2.2.15 cells. A Real-time visualization of tumors in mice from different groups. Bioluminescent images were obtained by injecting 150 μL of a 15 mg/mL solution of d-luciferin potassium salt into the peritoneal cavity on days 2, 5, 8, 11, and 14 after drug administration (day 1 post-injection); B Tumor volume growth curves of mice after different treatments. Tumor size was measured by bioluminescent intensity using the Xenogen IVIS SPECTRUM small animal imaging system; C Representative photographs of mouse livers on day 16; D , E Expression levels of AC099850.3 and CD276 measured by RT-qPCR and Western blot; F Immunohistochemical staining and quantitative analysis of CD276 in tumor tissues from different groups (Scale bar: 25 μm); G Evaluation of tumor cell necrosis by H&E staining and apoptosis by TUNEL staining in tumor tissues (Scale bar: 100 μm); * represents significant difference compared to the PBS group, P < 0.05; ** represents significant difference compared to the PBS group, P < 0.01; *** represents significant difference compared to the PBS group, P < 0.001; ## Compared to the CC@PP group, P < 0.01; N = 5

These findings suggest that the pH-sensitive CC@AC&SF@PP can be an ideal platform in the acidic tumor environment for enhancing the delivery of siRNA and SF to tumor cells, thereby enhancing the tumor suppression effect.

HBV-HCC is one of the most common types of liver cancer worldwide, and its treatment faces numerous challenges [ 1 , 40 ]. The mechanism of HBV-HCC development is complex, involving viral evasion mechanisms, immune tolerance, and the influence of the tumor microenvironment [ 40 , 41 ]. Currently, conventional treatment methods include chemotherapy and tumor resection, but drug resistance and high recurrence rates are often encountered [ 42 , 43 ]. In recent years, immunotherapy has emerged as a promising new treatment strategy for HBV-HCC [ 44 , 45 , 46 ]. Current research primarily focuses on exploring new therapeutic targets and developing innovative treatment strategies to improve the efficacy of HBV-HCC treatment [ 47 , 48 ].

In this study, it was found that the expression of AC099850.3 and the immune checkpoint CD276 is associated with tumor growth and progression in HBV-HCC [ 19 ]. This is consistent with similar results observed in previous studies in other types of tumors [ 4 , 36 ]. The immune checkpoint CD276 plays a key role in suppressing the immune response and promoting tumor escape [ 19 ]. The findings of this study further deepen our understanding of the functions and regulatory mechanisms of AC099850.3 and CD276 in HBV-HCC.

AC099850.3 may regulate CD276 through several molecular mechanisms. Primarily, it could enhance CD276 transcription by interacting with specific transcription factors or chromatin modifying factors. Additionally, AC099850.3 might stabilize CD276 mRNA, prolonging its half-life to ensure sustained expression. Furthermore, it could influence signaling pathways such as PI3K/AKT or MAPK/ERK, known to be associated with cell proliferation and immune checkpoint regulation. These pathways could further impact the expression and functional activity of CD276.

This study reveals the mechanism by which AC099850.3 regulates the expression of the immune checkpoint CD276 in HBV-HCC, and this regulation affects tumor proliferation and invasion by influencing the progression of the cell cycle (Fig.  9 ). This is in line with the functions of AC099850.3 observed in previous studies in different types of tumors [ 49 , 50 ]. The regulation of the cell cycle plays a crucial role in tumor development [ 51 ]. Therefore, this study is of significant importance for understanding the specific mechanisms of AC099850.3 in the progression of HBV-HCC.

AC099850.3 regulates immune checkpoint CD276 to modulate HBV-HCC cell proliferation and invasion: a novel strategy for SF and immune checkpoint combination therapy

The regulation of CD276 by AC099850.3 potentially involves multiple pathways. Studies indicate that AC099850.3 can interact with key signaling molecules like STAT3, which is known for its role in immune checkpoint regulation. By modulating STAT3 activity, AC099850.3 may indirectly impact CD276 expression. Moreover, AC099850.3 could alter the epigenetic landscape of the CD276 promoter region, modifying chromatin accessibility to facilitate transcriptional activation. These interactions underscore the complexity of the regulatory network between AC099850.3 and CD276.

This study successfully prepared a novel nanoparticle carrier, CC@AC&SF@PP, and applied it to the combination therapy of HBV-HCC. The nanoparticle carrier successfully delivered AC099850.3 siRNA and SF to the HBV-HCC site and showed the potential to enhance the efficacy of combination therapy. The design of this nanoparticle enables precise drug delivery and sustained release, thereby increasing the local drug concentration and duration of action, improving the therapeutic efficacy, and reducing side effects [ 52 ].

Based on the results, we can preliminarily draw the following conclusions: AC099850.3 accelerates the cell cycle progression and promotes the occurrence and development of HBV-HCC by upregulating the expression of immune checkpoint CD276. CC@AC&SF@PP NPs are loaded with AC099850.3 siRNA and SF for the purpose of combined therapy in situ HBV-HCC.

Future research should focus on identifying the precise molecular interactions between AC099850.3 and CD276. Techniques such as immunoprecipitation and chromatin immunoprecipitation experiments can be employed to determine the binding partners of AC099850.3 and their impact on the CD276 promoter region. Furthermore, investigating the downstream signaling pathways activated by CD276 under high levels of AC099850.3 can provide deeper insights into the proliferation and invasion mechanisms in HBV-HCC cells. Understanding these pathways is crucial for developing targeted therapies to disrupt the AC099850.3-CD276 axis.

This study carries significant scientific and clinical value. Firstly, we constructed a prognostic risk model with good sensitivity and specificity, which can be used to predict the survival of HBV-HCC patients through screening and analysis of the TCGA database and survival information. Secondly, through differential analysis and validation experiments, we identified AC099850.3 as a key gene and discovered its promotion of cell cycle progression in HBV-HCC by regulating immune checkpoint CD276 expression. Furthermore, we successfully prepared NPs loaded with AC099850.3 siRNA and SF, demonstrating their potential advantages in treating in situ HBV-HCC.

Despite the important findings of this study, there are still limitations. Firstly, the results of this study need further validation and confirmation due to the limited sample size. Secondly, the research results in animal models may differ from the actual situation in human patients. Therefore, more preclinical studies are needed to verify the effectiveness and safety of AC099850.3 and CC@AC&SF@PP NPs in HBV-HCC treatment further.

In future perspectives, further research can be conducted in several aspects. Firstly, larger sample sizes and multicenter clinical studies can be combined to verify the effectiveness and clinical application value of the prognostic risk model in different populations. Secondly, the role of AC099850.3 in HBV-HCC can be further studied to explore its interaction with other immune checkpoints and its potential in immune therapy. Lastly, clinical trials can be carried out to further validate the therapeutic efficacy and safety of nanoparticle drug delivery systems in HBV-HCC patients, promoting the clinical translation of this technology.

Retrieval of transcriptome sequencing data

We obtained gene expression data and survival information for liver cancer patients from the UCSC Xena database ( https://xena.ucsc.edu/ ). The downloaded data was in FPKM format. Additionally, we retrieved clinical data for liver cancer patients from the TCGA database, including HBV information, as described in [ 53 ]. From this data, we extracted the clinical data for HBV-HCC patients (Table S6). Since these data were sourced from publicly available databases, no ethical approval or informed consent was required.

Construction of weighted gene co-expression networks

We performed clustering analysis on the HBV-HCC samples using the "hclust" package in R software to establish a co-expression network. Subsequently, the "WGCNA" package in R was utilized to construct the gene co-expression network. To build the weighted co-expression network, we selected the top 25% of genes ranked by variance and calculated the Pearson correlation coefficients between them. We determined an appropriate soft thresholding power β to meet the criteria for a scale-free network. The adjacency matrix was transformed into a topological overlap matrix (TOM), and hierarchical clustering was applied in the gene-level hierarchical clustering tree. The MEbrown module, which showed the highest correlation with survival status, was selected for further analysis. Next, we downloaded immune-related gene sets from the ImmPort database and extracted immune-related mRNA from the MEbrown module. Finally, we identified lncRNA with correlation to the immune-related mRNA in the MEbrown module [ 54 ].

Extraction of mRNA and lncRNA related to immunity

To extract genes related to immunity, we utilized the ImmPort database ( https://www.immport.org/shared/home ). The “UpSetR” package in R software was employed to intersect the MEbrown module genes from the co-expression network weighted by gene expression and the gene set associated with immunity. This intersection provided us with a collection of mRNA genes related to immunity. We then employed a matrix correlation analysis tool to examine the correlation between mRNA and lncRNA. By setting the threshold at R = 0.4 and P < 0.001, we obtained lncRNA data that were associated with immunity [ 55 , 56 ].

Construction of prognostic risk model and prognostic correlation analysis

In this study, we divided a total of 44 HBV-HCC patient samples from the TCGA database into a training set (Train, including 24 patient samples) and a testing set (Test, including 20 patient samples) using a random method. We utilized the "survival" package in the R language to perform univariate Cox regression analysis on genes related to overall survival, selecting genes with a significance level of P < 0.05 and hazard ratios (HR) as potential candidate biomarkers. Subsequently, we employed the LASSO Cox regression model to determine the optimal coefficients and calculate the penalized likelihood. Based on the highest lambda value (lambda.min) obtained from 1000-fold cross-validation in the LASSO method, we identified a set of prognostic genes along with their corresponding LASSO coefficients and ultimately constructed a prognostic risk model based on the expression levels of these genes. The calculation method for the prognostic model score is as follows: Prognostic score = (β1 × expression level of gene 1) + (β2 × expression level of gene 2) + … + (βn × expression level of gene n).

Using the median score of the training set as the cutoff, we divided the training set, testing set, and the entire sample set (All) into high-risk and low-risk groups. We evaluated whether the risk score could serve as an independent prognostic factor through univariate Cox analysis and multivariate Cox analysis. Additionally, we compared the overall survival difference between the high-risk and low-risk groups using Kaplan–Meier survival curves, using a significance level of P < 0.05. The “timeROC” package in R was employed to plot the ROC (receiver operating characteristic) curve of the prognostic risk model, and the accuracy of the prognostic risk model for HBV-HCC patient prognosis was assessed based on the area under the curve (AUC). Lastly, using the “survival” package and “survminer” package in R, we plotted the survival curves of the prognostic risk model and calculated the corresponding P-values [ 57 , 58 , 59 ].

Differential gene analysis

We performed differential gene analysis using HBV-HCC RNA-Seq data, consisting of 50 normal samples and 44 tumor samples. To identify differentially expressed genes, we applied filter conditions of |log2FC|> 1 and P < 0.05, using the limma package in R. Subsequently, we generated a heatmap and a volcano plot using the pheatmap and ggplot2 packages in R, respectively. Additionally, we employed the ggplot2 package to visualize gene expression patterns among the 50 normal and 44 tumor samples. Furthermore, we extracted 8 pairs of matched samples and illustrated the gene expression profiles of key genes in these paired samples. All analyses were performed using R version 4.2.1 (R Foundation for Statistical Computing) [ 56 ].

Bioinformatics analysis of key genes in HBV-HCC

Based on the median expression values of key genes, we divided the HBV-HCC tumor samples into high and low-expression groups. The overall survival difference between the high and low expression groups was compared using Kaplan–Meier survival curve analysis, with a cutoff value of P < 0.05. We utilized the “timeROC” package in R language to draw time-related ROC curves and assess the accuracy of disease status prediction based on gene expression.

CIBERSORT is a gene expression-based deconvolution algorithm used to describe the cellular composition of complex tissues. We stratified the samples into high and low-expression groups based on the expression levels of key genes. By combining the “e1071” and “preprocessor” packages in R software with the CIBERSORT algorithm, immune cell composition analysis was performed on HBV-HCC tumor samples. The content of immune cells was calculated for each sample and simulated 100 times, with results with P < 0.05 retained. Subsequently, the “vioplot” package in R software was used for differential analysis of immune cells. The correlation between immune cells was evaluated using the “ggplot2,” “ggpubr,” and “ggExtra” packages in R software, employing Spearman’s correlation coefficient. To investigate the relationship between AC099850.3 and immune checkpoint as well as AC099850.3 and tumor mutation burden, the “ggplot2” and “ggpubr” packages in R software were employed, and results with P < 0.05 were retained [ 60 , 61 , 62 , 63 , 64 , 65 ].

Gene function enrichment analysis

A tool for calculating matrix correlation was used to analyze the correlation between AC099850.3 and the gene expression matrix. Based on the threshold of R = 0.7 and P < 0.001, the co-expressed genes of AC099850.3 were identified. The “clusterProfiler” package in R was utilized for Gene Ontology (GO) and KEGG enrichment analysis of AC099850.3 and its co-expressed genes. Subsequently, the “enrichplot” package was employed to generate bar plots and bubble plots for the enrichment results of three GO categories: biological process (BP), cellular component (CC), and molecular function (MF). Furthermore, bar plots and bubble plots were produced for the KEGG enrichment analysis results [ 66 ].

In vitro cell culture

HepG2 2.2.15 (CL0549) human liver cancer cells infected with HBV were purchased from Fenghui Biotech. The cells were cultured in a specific medium for HepG2/2.2.15 (CM-0594, Procell), which comprised MEM (containing NEAA) + 10% FBS + 380 μg/mL G418 + 1% P/S [ 67 ].

Cell treatment and grouping

When HepG2 2.2.15 cells were in the logarithmic growth phase, they were digested with trypsin and seeded at a density of 1 × 10 5 cells per well in a 6-well plate. After conventional incubation for 24 h, when the cell confluency reached approximately 75%, cell transfection was performed according to the transfection protocol of Lipofectamine 2000 (11668-019, ThermoFisher). The plasmid concentration used was 50 ng/mL. The target sequences for siRNA were as follows: AC099850.3-siRNA1: CTGCTATGGACTTCAGAGA; AC099850.3-siRNA2: CCAGGCTGTATTACTGTCT; AC099850.3-siRNA3: GCGTCACCATGCCTGGGTA; CD276-siRNA1: CAACGAGCAGGGCTTGTTTGA; CD276-siRNA2: CTAGCCTTAATACTGGCCTTT; CD276-siRNA3: GCTTGTTTGATGTGCACAGCA. The overexpression vector pcDNA3.1 and siRNA sequences were designed and constructed by Gima Genes (Shanghai, China), and the knockout efficiency was validated using RT-qPCR.

HepG2 2.2.15 cells are seeded at a density of 5 × 10 5 cells per well in a 6-well plate and incubated for 24 h in a fresh culture medium. After centrifugation to remove the culture medium, the cells are washed with PBS and resuspended in 1 mL of opti-MEM (31985070, ThermoFisher) medium. Then, 5 μL of CC@PP, CC@AC&SF@PP, and AC&SF (siRNA concentration of 20 μM, pH 6.5) are added, respectively. After 6 h, 1.5 mL of fresh culture medium is added. Cells are collected for subsequent analysis after 72 h.

The cells were divided into the following groups for the study: si-NC group (transfected with lentivirus si-NC), si-AC099850.3 group (transfected with lentivirus AC099850.3-siRNA2), si-CD276 group (transfected with lentivirus CD276-siRNA2), si-AC099850.3 + oe-NC group (co-transfected with lentivirus AC099850.3-siRNA2 and oe-NC transfected with empty vector), si-AC099850.3 + oe-CD276 group (co-transfected with lentivirus AC099850.3-siRNA2 and oe-CD276, where oe-CD276 denotes cells overexpressing the CD276 gene), Control group, CC@PP group (treated with CMCS-coated mPEG5K-PAE10K NPs), CC@AC&SF@PP group (treated with a combination of AC099850.3 siRNA and SF co-loaded mPEG5K-PAE10K NPs), and AC&SF group (treated with free AC099850.3 siRNA and SF) [ 68 ].

Cell cycle analysis

HepG2 2.2.15 cells were collected and washed twice with PBS buffer. Subsequently, the cells were suspended in pre-chilled PBS containing 70% ethanol and incubated at 4 ℃ for 4 h. Afterward, the cells were washed twice with pre-chilled PBS and incubated with PBS containing 0.2% Triton X-100 and 10 μg/mL RNase at 37 ℃ for 30 min. Following the incubation, the cells were stained with 400 μL propidium iodide (PI) solution (50 g/mL, HY-D0815, MCE) in the dark at 4 ℃ for 30 min. Finally, the cell cycle distribution was analyzed using a flow cytometer (CytoFLEX, Beckmancoulter) and the accompanying software [ 69 ].

CCK-8 assay

Transfected HepG2.2.15 cells (100 μL) were seeded into a 96-well plate and incubated in a cell culture incubator for 0, 24, 48, 72, and 96 h. After the respective incubation periods, CCK-8 reagent (K1018, Apexbio) was added to each well, followed by a 2-h incubation period. The absorbance was measured at 450 nm [ 67 ]. Each experiment was performed with 5 parallel wells and repeated independently three times.

Clone formation assay

After cell transfection, the cells were seeded at a density of 1 × 10 5 cells per well in a 6-well plate and incubated for 2–3 weeks until visible cell clones were formed. The culture medium was then aspirated, and the cells were washed with PBS. Next, 4% paraformaldehyde was added to each well for cell fixation, and the cells were incubated for 15 min. After removing the fixative, 1 mL of Giemsa staining solution (C0131, Beyotime) was slowly added along the walls of each well, and the cells were stained in the dark for 20 min. Subsequently, the Giemsa staining solution was washed away with running water. The 6-well plate was inverted onto a clean paper towel, and the number of cell clones was calculated [ 67 ].

Transwell assay

Forty-eight hours after cell transfection, a Transwell invasion assay was performed. First, 50 μL of matrix gel (354234, BD Biosciences, USA) was coated in the Transwell chambers and allowed to solidify at 37 ℃ for 30 min. After coating, the chambers were rinsed with an FBS-free medium. Cells were diluted to a concentration of 2.5 × 10 4 cells/mL, and 100 μL of cell suspension was added to each well of the upper chamber, while 500 μL of medium supplemented with 10% FBS was added to the lower chamber. After 24 h, the chambers were removed, and the cells in the upper chamber were gently removed using a cotton swab. The cells were fixed with 4% PFA for 30 min at room temperature. Subsequently, the cells were stained with 0.1% crystal violet for 30 min. Five random areas were selected, and images were captured using an inverted microscope. The number of cells was then calculated [ 70 , 71 ].

Scratch experiment

Logarithmic phase cells were harvested and prepared as a single-cell suspension at a concentration of 5 × 10 5 cells/mL. The cells were then evenly seeded in a 6-well plate. After 24 h, the cells in each group were subjected to the corresponding treatments and incubated in a 37℃, 5% CO 2 cell culture incubator for 24 h. A scratch was made on the surface of the cells in each well using a 100 μL sterile pipette tip. During scratching, the tip was kept vertical, and efforts were made to ensure that the width of scratches in each group was consistent. The culture medium in the 6-well plate was discarded, and the cells were washed twice with PBS. Serum-free medium was added for further incubation. The cells were observed and photographed, and the width of the scratch was measured at 0 h as a control. The 6-well plate was placed in a 37℃, 5% CO 2 cell culture incubator for 24 h to allow cell migration. The migrated cells were observed and photographed, and the migration rate was calculated as (width of scratch at 0 h—width of scratch at 24 h) / width of scratch at 0 h × 100% [ 67 ].

Flow cytometry

The Annexin V-FITC Apoptosis Staining/Detection Kit (ab14085, abcam) was used for cell analysis. The cell density was adjusted to 1 × 10 5 cells/mL for each group. Three milliliters of cell suspension were taken for each group and centrifuged at 500 rpm for 5 min in a 10 mL centrifuge tube. After removal of the culture medium, the cells were resuspended in 100 μL of binding buffer, followed by the addition of 5 μL Annexin V-FITC and 5 μL PI. The mixture was gently mixed and incubated at room temperature in the dark for 15 min. Flow cytometry was performed to detect FITC fluorescence and PI fluorescence. Q1: Upper left quadrant (UL) represented cell debris with no cell membrane or dead cells due to other causes; Q2: Upper right quadrant (UR) represented late apoptotic cells; Q3: Lower left quadrant (LL) represented viable (live) cells; Q4: Lower right quadrant (LR) represented early apoptotic cells. The apoptotic rate was analyzed by assessing the percentages of cells in the Q2 and Q4 quadrants [ 67 ].

Subcutaneous transplanted tumor experiment in mice

All animal experiments in this study were conducted in accordance with the regulations and guidelines of our institutional animal ethics committee and approved by the committee. We made efforts to minimize animal pain and distress and to reduce the number of animals required for the experiments. Animal housing, handling, and experimental procedures were strictly performed according to internationally recognized animal welfare standards. Appropriate care was provided to all animals, and proper handling after the experiments was ensured. Male C57BL/6N nude mice (4–5 weeks old, weighing 18–22 g) were purchased from Beijing Vital River Laboratories. They were housed in SPF-grade animal facilities with constant humidity (45–50%) and temperature (25–27 °C) for 1 week, with a 12-h light–dark cycle, to acclimatize to the experimental environment. The mice fasted for 12 h prior to drug administration and were allowed free access to food and water at other times [ 72 , 73 ]. All our animal experimental procedures were approved by our institutional animal ethics committee. We randomly divided 20 nude mice into 4 groups: si-NC group, si-AC099850.3 group, si-AC099850.3 + oe-NC group, and si-AC099850.3 + oe-CD276 group, with 5 mice in each group. HepG2.2.15 cells (5 × 10 6 /0.2 mL) were injected subcutaneously into the back of the mice. After 3 weeks, we measured the width (W) and length (L) of the tumors in each group using a caliper to monitor tumor growth and calculated tumor volume (V) using the formula V = (W 2  × L)/2. The mice were euthanized, and the tumor tissues were dissected and removed for weighing. The tumor tissues were divided into two parts, with one part used for TUNEL staining and H&E staining and the other part frozen and stored in liquid nitrogen for subsequent experimental analysis [ 74 , 75 ].

Hematoxylin and Eosin (H&E) staining

The tumor tissue was fixed in a 4% formalin solution at 4 °C for 8 h. Subsequently, it was soaked in a 70% ethanol solution for 5 min, followed by dehydration in a gradient of 80%, 90%, 95%, and absolute ethanol for 4 h. Then, the tissue was immersed in xylene for 30 min, embedded in paraffin, and cut into consecutive 3 μm-thick sections. A total of ten sections were taken from each sample for H&E staining. The sections were initially stained with hematoxylin (Sigma, H9627) for 5 min, followed by 5-min staining with 1% aqueous eosin (National Pharmaceutical Group, 71014544). Finally, the sections were soaked in water. After subsequent immersion in ethanol (National Pharmaceutical Group, 10009218) and xylene (National Pharmaceutical Group, 10023418), they were sealed with neutral gum (National Pharmaceutical Group, 10004160) and observed under an Olympus microscope (BX53) [ 69 ].

TUNEL assay

The tissue sections were incubated at room temperature for 20 min in a solution of 100 μL proteinase K (20 g/mL concentration) per section, ensuring complete coverage. After rinsing with deionized water, the sections were stained with a Cell Apoptosis Detection Kit (Solarbio, T2190) and DAPI (Beyotime, C1002). The stained sections were observed and photographed using an Olympus microscope (BX53) [ 69 ].

Preparation of SF@PP NPs

Analytical-grade chloroform, methanol, polyoxymethylene, triethylamine (TEA), and acetonitrile (ACN, HPLC) were obtained from the National Pharmaceutical Group. The biological materials and preparations used in this study were SF (HY-10201, 99.92%, MCE), mPEG5K-PAE10K (Q-0265422, Xi'an Qi Yue Biotechnology Co., Ltd.), carboxymethyl chitosan (CMCS, C9400, MW = 20,000–50,000, degree of carboxylation 87–90%, Solarbio), D-Luciferin potassium salt (HY-12591B, MCE), and DEPC water (HY-156262, MCE).

SF@PP NPs loaded with SF were prepared using a single emulsion method. 1 mg of SF was dissolved in 1 mL of chloroform/methanol (1:1, v/v) and dropped into a stirring solution containing 10 mg of mPEG5K-PAE10K in 10 mL of chloroform/methanol (1:1, v/v). Then, the mixture was gently stirred for 1 h at room temperature before being dropped into 10 mL of pre-stirred DEPC water. The mixture was subjected to ultrasonication using an intelligent ultrasonic cell disruptor (SCIENTZ-950E, Ningbo Xinzhi Biotechnology Co., Ltd.) set at 275 W for 4 min, with the pulse off for 1.5 s after every 8 s to prevent excessive heat generation. After evaporating the organic solvent using a rotary evaporator, excess SF was removed by centrifugation at 4000 rpm for 20 min using an Amicon Ultra-15 centrifugal filter unit (UFC900324, Sigma). The filtrate was collected, and the residual amount of SF was determined by high-performance liquid chromatography. Finally, the synthesized SF@PP NPs solution was filtered through a syringe filter (0.45 μm, Millipore) and stored in DEPC water at 4 °C [ 28 ].

Preparation of AC&SF@PP NPs

A total of 5 μL of AC099850.3 siRNA was dissolved in 20 μL of DEPC water and mixed with different volumes of 1 mg/mL SF@PP NPs (containing SF). An excess amount of DEPC water was added to achieve a final reaction volume of 100 μL. The mixture was vortexed for 15 s and incubated at room temperature for 30 min. The optimal mass ratio of siRNA to SF@PP NPs (1:4) was determined using agarose gel electrophoresis. The original AC&SF@PP NPs solution was stored in 4 ℃ DEPC water for further use [ 28 ].

Preparation of CC@AC&SF@PP NPs

For the preparation of CC@AC&SF@PP NPs, the obtained AC&SF@PP NPs were added dropwise to CMCS solutions with different concentrations and stored at room temperature for 30 min. The optimal mass ratio of mPEG5K-PAE10K/SF/AC099850.3 siRNA/CMCS was determined to be 40:4:1:1. The solution of CC@AC&SF@PP NPs was stored in 4 ℃ DEPC water for subsequent use [ 28 ].

Characterization of CC@AC&SF@PP NPs

NPs were negatively stained with 2% (w/v) uranyl acetate for characterization. The morphology of CC@AC&SF@PP NPs was examined using JEM-2100F transmission electron microscopy (TEM) at Qingdao FeiYoute Laboratory. The absorption spectra were recorded using a UV–Vis spectrophotometer from China AOE Instrumentation. The average hydrodynamic diameter distribution and zeta potential were determined using a Zetasizer Nano ZS90 particle analyzer from Malvern [ 28 ].

In vitro drug release study

The release behavior of SF from CC@AC&SF@PP NPs was investigated in PBS at pH 7.4 and pH 6.5, respectively, at 37 ℃. A 1 mL solution of CC@AC&SF@PP NPs (SF concentration: 0.1 mg/mL) was transferred to a 14 kDa MWCO dialysis bag (Shanghai Maokang Biotechnology Co., Ltd., MP1719-5 M). The dialysis bag was securely tied with cotton thread and immersed in 13 mL of pH 7.4 or pH 6.5 PBS (1% v/v Tween-80 was added to the PBS solution to enhance the dispersion of SF). The temperature was maintained at 37 ℃ with continuous shaking (150 rpm). At specific time intervals (i.e., 0, 1, 2, 4, 8, 12, 24, 48, 60, 72 h), 500 μL of the release medium was withdrawn and replaced with an equal volume of fresh PBS. The drug release rate was determined using high-performance liquid chromatography [ 28 ]. The release experiments were conducted in triplicate, and the results were reported as the mean data.

The release behavior of SF from CC@AC&SF@PP NPs was investigated in PBS at pH 7.4 and pH 6.5, respectively, at 37 ℃. The pH 6.5 condition was chosen to mimic the slightly acidic environment of the tumor microenvironment, enhancing the relevance of the drug release and cellular uptake experiments.

In vitro cell uptake assay

HepG2 2.2.15 cells were seeded in a 6-well cell culture plate at a density of 1 × 10 6 cells/well and incubated overnight in a fresh culture medium. The cells were washed three times with PBS buffer and resuspended in 1 mL of opti-MEM medium. Then, 10 μL of Cy3-AC099850.3 siRNA (20 μM, complexed with Lipo2000) or CC@AC&SF@PP NPs (equivalent amount of siRNA, incubated at pH 6.5 or 7.4) were added to the cells, with each group performed in triplicate. The plates were incubated at 4 ℃ for 6 h to avoid nonspecific adsorption. The cells were washed three times with PBS and subjected to fluorescence imaging analysis [ 28 ].

HBV-HCC in situ tumor model

Male NOD-SCID mice (6 weeks old, weighing 18–22 g) were purchased from Spbf Biotechnology Co., Ltd. (Beijing). All mice were housed in a controlled environment barrier facility with a 12-h light/dark cycle, temperature (24 ± 1 ℃), and humidity (50 ± 10%), and had ad libitum access to food and water [ 76 ]. Male NOD-SCID mice were anesthetized by inhalation of isoflurane using a small animal anesthesia machine. After disinfection, the abdomen was opened at the midline, and the median lobe of the liver was exposed. Then, 1 × 10 6 HepG2 2.2.15 cells dissolved in 50 μL PBS were injected into the liver. The median lobe of the liver was gently reinserted into the abdominal cavity, and the incision was closed layer by layer, followed by disinfection with iodine tincture. After anesthesia recovery, the mice were returned to their original housing environment for approximately 1 week. Tumor-bearing mice were randomly divided into six groups: PBS group, CC@PP group, CC@AC@PP group, CC@NC&SF@PP group, CC@AC&SF@PP group, and AC&SF group (n = 5 per group). Different materials (100 μL) were intravenously injected on days 1, 4, 7, 10, and 13, with an siRNA dose of 2.5 mg/kg and an SF dose of 10 mg/kg. One day after injection, a solution of D-luciferin potassium salt (HY-12591B, MCE) at a concentration of 15 mg/mL was injected intraperitoneally (150 μL), and the anesthetized mice were placed in a bioluminescence imaging system. The imaging system detected the light signal produced by tumor cells and quantified the tumor size. Mice were euthanized 3 days after the last drug injection, and subsequent experiments were conducted using whole liver samples [ 28 ].

In vivo tumor uptake assay

For in vivo fluorescence imaging, a partial volume of 100 μL of Cy5-AC099850.3 siRNA or CC@AC&SF@PP NPs (siRNA concentration of 0.5 mg/mL) was intravenously injected into tumor-bearing BALB/c mice. Six hours after injection, we obtained fluorescence images using a small animal in vivo imaging system (CLS136340, IVIS Lumina XRMS). Following anesthesia with isoflurane, we exposed the internal organs of the mice for contrast imaging. After imaging, we retrieved major organs such as lungs, hearts, kidneys, livers, and spleens and imaged them on the same imaging system.

To analyze the distribution of the drug in the tumor of the mice, we embedded the tumor tissue in an optimal cutting temperature compound (OCT). Tumor tissue sections were obtained using an RWD Minux FS800 and mounted on glass slides. Subsequently, the sections were fixed in 4% paraformaldehyde for 15 min and stained with a 10 μg/mL Hoechst 33,258 solution for nuclear staining for 10 min. The sections were then washed with PBS, and fluorescence images were acquired using a confocal microscopy system [ 28 ].

Immunohistochemical staining

Tumor tissues from mice were obtained and fixed, followed by decalcification. The samples were then dehydrated using a graded ethanol series and embedded in paraffin. Subsequently, 5 μm thick sections were cut. The sections were baked at 60 °C for 20 min and then sequentially immersed in xylene solution, with each immersion lasting 15 min and xylene solution being replaced in between. After dehydration in anhydrous ethanol for 5 min, further dehydration was performed in a graded ethanol series (70% and 95%) for 10 min each.

To block endogenous peroxidase activity, each section was treated with 3% H 2 O 2 at room temperature for 10 min. Citrate buffer was added, and the sections were microwaved for 3 min. After that, the sections were incubated at room temperature for 10 min with an antigen retrieval solution, followed by washing them with PBS three times. Normal goat serum-blocking solution was then applied to the tissue sections, which were subsequently incubated at room temperature for 20 min. A primary antibody, Anti-CD276 antibody (ab219648, 1:4000, Abcam, UK), was added to the sections and incubated overnight at 4 °C.

The next day, a goat anti-rabbit IgG secondary antibody (ab6721, 1:1000) was added and incubated for 30 min. SABC (SA0041, Solarbio) was then added and kept at 37 °C for 30 min. DAB chromogenic reagent (DA1010, Solarbio) was added to the sections and incubated for 6 min. Subsequently, the sections were counterstained with hematoxylin for 30 s. Dehydration was performed using graded ethanol series (70%, 80%, 90%, and 95%) and anhydrous ethanol for 2 min each. Finally, the sections were cleared twice with xylene for 5 min each before being mounted with neutral resin and observed under a light microscope (BX63, Olympus, Japan). The experiment was performed in triplicate. PBS was used instead of the primary antibody as a negative control.

For quantitative analysis, five different fields of view containing immunohistochemistry (IHC) images were selected. The number of cells with brown staining signals in the cytoplasm was counted as positive stained cells, and the total number of cells in each field was also recorded. The percentage of positive cells was calculated as the number of positive stained cells divided by the total number of cells and multiplied by 100% [ 77 ].

Total RNA was extracted from tissues and cells using Thermo Fisher's Tissue RNA Extraction Kit (12183018A) and Cell RNA Extraction Kit (12183020), respectively, following the standard protocol provided. Subsequently, 1 μg of total RNA was reverse transcribed into cDNA using Fermentas' First Strand cDNA Synthesis Kit (K1622). The synthesized cDNA was then subjected to RT-qPCR analysis using Applied Biosystems’ Fast SYBR Green PCR Kit and ABI PRISM 7500 RT-PCR System, with three replicates per well. The relative expression levels of mRNA were calculated using the 2 −ΔΔCt method, where ΔΔCt = (average Ct value of target gene in experimental group—average Ct value of reference gene in experimental group)—(average Ct value of target gene in control group—average Ct value of reference gene in control group). GAPDH was used as the reference gene. The RT-qPCR reactions were performed in an Applied Biosystems StepOnePlus instrument, with reaction conditions consisting of one cycle at 95 ℃ for 15 min, followed by 40 cycles, each comprising 10 s at 95 ℃ and 60 s at 60 ℃ [ 68 ]. For primer sequences, please refer to Table S7. The required reagents and consumables for these experiments were purchased from Wuhan Sibaire Biotechnology Co., Ltd.

Western blot analysis

Proteins were extracted from mouse tumor tissue and HepG2.2.15 cells using the Solarbio Tissue Protein Extraction Kit (EX2171) and Cell Protein Extraction Kit (EX2170), respectively. The protein concentration was determined using the Sigma BCA Protein Assay Kit (BCA1-1KT). Equal amounts of protein (20 µg per lane) were subjected to 10–12% SDS-PAGE electrophoresis. Following electrophoresis, the proteins were transferred to polyvinylidene fluoride (PVDF) membranes from EMD Millipore. The membranes were then blocked with 5% BSA for 2 h, washed with PBS, and incubated overnight at 4℃ with primary antibodies (details of primary antibody manufacturers can be found in Table S8). The primary antibodies used were anti-GAPDH antibody (ab9485, 1:2500) and anti-CD276 antibody (ab105922, 1:1000) provided by Abcam. Subsequently, the membrane was incubated with a secondary antibody, goat anti-rabbit horseradish peroxidase-conjugated antibody (ab6721, 1:2000), from Abcam at room temperature for 2 h after washing. Visualization was done using the enhanced chemiluminescence system (iBright FL1500) from Thermo Fisher. The experiment was repeated three times. The experiments were repeated three times.

Statistical analysis

Data were analyzed using SPSS 21.0 (SPSS, Inc., Chicago, IL, USA). Numerical data are presented as mean ± standard deviation. Independent sample t-tests were used for comparisons between two groups, while one-way analysis of variance (ANOVA) was used for comparisons among multiple groups. Categorical data are presented as proportions or percentages, and comparisons were performed using the Chi-square test. A significance level of P < 0.05 was considered statistically significant.

Availability of data and materials

Anonymized data and code used in conducting the analyses will be made available upon request directed to the corresponding author.

Rizzo GEM, Cabibbo G, Craxì A. Hepatitis B virus-associated hepatocellular carcinoma. Viruses. 2022;14(5):986. https://doi.org/10.3390/v14050986 .

Article   PubMed   PubMed Central   CAS   Google Scholar  

You M, Gao Y, Fu J, et al. Epigenetic regulation of HBV-specific tumor-infiltrating T cells in HBV-related HCC. Hepatology. 2023;78(3):943–58. https://doi.org/10.1097/HEP.0000000000000369 .

Article   PubMed   Google Scholar  

Li YT, Wu HL, Liu CJ. Molecular mechanisms and animal models of HBV-related hepatocellular carcinoma: with emphasis on metastatic tumor antigen 1. Int J Mol Sci. 2021;22(17):9380. https://doi.org/10.3390/ijms22179380 .

Zhou J, Zhang M, Dong H, et al. Comprehensive analysis of acetylation-related lncRNAs and identified AC099850.3 as prognostic biomarker in non-small cell lung cancer. J Oncol. 2021;2021:4405697. https://doi.org/10.1155/2021/4405697 .

Chen X, Guo J, Zhou F, et al. Over-expression of long non-coding RNA-AC099850.3 correlates with tumor progression and poor prognosis in lung adenocarcinoma. Front Oncol. 2022;12:895708. https://doi.org/10.3389/fonc.2022.895708 .

Yue G, Tang J, Zhang L, Niu H, Li H, Luo S. CD276 suppresses CAR-T cell function by promoting tumor cell glycolysis in esophageal squamous cell carcinoma. J Gastrointest Oncol. 2021;12(1):38–51. https://doi.org/10.21037/jgo-21-50 .

Article   PubMed   PubMed Central   Google Scholar  

Liu S, Liang J, Liu Z, et al. The role of CD276 in cancers. Front Oncol. 2021;11: 654684. https://doi.org/10.3389/fonc.2021.654684 .

Zhou WT, Jin WL. B7–H3/CD276: an emerging cancer immunotherapy. Front Immunol. 2021;12: 701006. https://doi.org/10.3389/fimmu.2021.701006 .

Garbayo E, Pascual-Gil S, Rodriguez-Nogales C, Saludas L, Estella-Hermosode Mendoza A, Blanco-Prieto MJ. Nanomedicine and drug delivery systems in cancer and regenerative medicine. Wiley Interdiscip Rev Nanomed Nanobiotechnol. 2020;12(5):e1637. https://doi.org/10.1002/wnan.1637 .

Article   PubMed   CAS   Google Scholar  

Kumagai M. Rinsho Byori. 1987;35(2):161–166.

Li Z, Xiao C, Yong T, Li Z, Gan L, Yang X. Influence of nanomedicine mechanical properties on tumor targeting delivery. Chem Soc Rev. 2020;49(8):2273–90. https://doi.org/10.1039/c9cs00575g .

Snipstad S, Vikedal K, Maardalen M, Kurbatskaya A, Sulheim E, Davies CL. Ultrasound and microbubbles to beat barriers in tumors: Improving delivery of nanomedicine. Adv Drug Deliv Rev. 2021;177: 113847. https://doi.org/10.1016/j.addr.2021.113847 .

Pearce AK, O’Reilly RK. Insights into active targeting of nanoparticles in drug delivery: advances in clinical studies and design considerations for cancer nanomedicine. Bioconjug Chem. 2019;30(9):2300–11. https://doi.org/10.1021/acs.bioconjchem.9b00456 .

Patra JK, Das G, Fraceto LF, et al. Nano based drug delivery systems: recent developments and future prospects. J Nanobiotechnol. 2018;16(1):71. https://doi.org/10.1186/s12951-018-0392-8 .

Article   CAS   Google Scholar  

Singh S. Nanomedicine-nanoscale drugs and delivery systems. J Nanosci Nanotechnol. 2010;10(12):7906–18. https://doi.org/10.1166/jnn.2010.3617 .

Zhong F, Liu S, Hu D, Chen L. LncRNA AC099850.3 promotes hepatocellular carcinoma proliferation and invasion through PRR11/PI3K/AKT axis and is associated with patients prognosis. J Cancer. 2022;13(3):1048–60. https://doi.org/10.7150/jca.66092 .

Cheng Z, Han J, Jiang F, Chen W, Ma X. Prognostic pyroptosis-related lncRNA signature predicts the efficacy of immunotherapy in hepatocellular carcinoma. Biochem Biophys Rep. 2022;32:101389. https://doi.org/10.1016/j.bbrep.2022.101389 .

Wu F, Wei H, Liu G, Zhang Y. Bioinformatics profiling of five immune-related lncRNAs for a prognostic model of hepatocellular carcinoma. Front Oncol. 2021;11:667904. https://doi.org/10.3389/fonc.2021.667904 .

Li N, Shen J, Qiao X, Gao Y, Su HB, Zhang S. Long non-coding RNA signatures associated with ferroptosis predict prognosis in colorectal cancer. Int J Gen Med. 2022;15:33–43. https://doi.org/10.2147/IJGM.S331378 .

Wang Q, Fang Q, Huang Y, Zhou J, Liu M. Identification of a novel prognostic signature for HCC and analysis of costimulatory molecule-related lncRNA AC099850.3. Sci Rep. 2022;12(1):9954. https://doi.org/10.1038/s41598-022-13792-z .

Pinyol R, Montal R, Bassaganyas L, et al. Molecular predictors of prevention of recurrence in HCC with sorafenib as adjuvant treatment and prognostic factors in the phase 3 STORM trial. Gut. 2019;68(6):1065–75. https://doi.org/10.1136/gutjnl-2018-316408 .

Koeberle D, Dufour JF, Demeter G, et al. Sorafenib with or without everolimus in patients with advanced hepatocellular carcinoma (HCC): a randomized multicenter, multinational phase II trial (SAKK 77/08 and SASL 29). Ann Oncol. 2016;27(5):856–61. https://doi.org/10.1093/annonc/mdw054 .

Bondì ML, Scala A, Sortino G, et al. Nanoassemblies based on supramolecular complexes of nonionic amphiphilic cyclodextrin and sorafenib as effective weapons to kill human HCC cells. Biomacromol. 2015;16(12):3784–91. https://doi.org/10.1021/acs.biomac.5b01082 .

So YJ, Frentzas S, Segelov E. Is there a place for Ramucirumab after Sorafenib in patients with advanced HCC? Hepatobiliary Surg Nutr. 2019;8(5):546–8. https://doi.org/10.21037/hbsn.2019.04.14 .

Younis MA, Khalil IA, Elewa YHA, Kon Y, Harashima H. Ultra-small lipid nanoparticles encapsulating sorafenib and midkine-siRNA selectively-eradicate sorafenib-resistant hepatocellular carcinoma in vivo. J Control Release. 2021;331:335–49. https://doi.org/10.1016/j.jconrel.2021.01.021 .

de Jong YP, Herzog RW. Liver gene therapy and hepatocellular carcinoma: a complex web. Mol Ther. 2021;29(4):1353–4. https://doi.org/10.1016/j.ymthe.2021.03.009 .

Angelici B, Shen L, Schreiber J, Abraham A, Benenson Y. An AAV gene therapy computes over multiple cellular inputs to enable precise targeting of multifocal hepatocellular carcinoma in mice. Sci Transl Med. 2021;13(624):eabh4456. https://doi.org/10.1126/scitranslmed.abh4456 .

Song C, Zhang J, Wen R, et al. Improved anti-hepatocellular carcinoma effect by enhanced Co-delivery of Tim-3 siRNA and sorafenib via multiple pH triggered drug-eluting nanoparticles. Mater Today Bio. 2022;16:100350. https://doi.org/10.1016/j.mtbio.2022.100350 .

Tan Y, Xu Q, Wu Z, et al. Overexpression of PD-L1 is an independent predictor for recurrence in HCC patients who receive sorafenib treatment after surgical resection. Front Oncol. 2022;11:783335. https://doi.org/10.3389/fonc.2021.783335 .

Chu PY, Chan SH. Cure the incurable? Recent breakthroughs in immune checkpoint blockade for hepatocellular carcinoma. Cancers (Basel). 2021;13(21):5295. https://doi.org/10.3390/cancers13215295 .

Zhang F, Cai J, Hu K, et al. An immune-related gene signature predicting prognosis and immunotherapy response in hepatocellular carcinoma. Comb Chem High Throughput Screen. 2022;25(13):2203–16. https://doi.org/10.2174/1386207325666220304115006 .

Fu M, Wang Q, Wang H, et al. Immune-related genes are prognostic markers for prostate cancer recurrence. Front Genet. 2021;12:639642. https://doi.org/10.3389/fgene.2021.639642 .

Li L, Xia S, Shi X, Chen X, Shang D. The novel immune-related genes predict the prognosis of patients with hepatocellular carcinoma. Sci Rep. 2021;11(1):10728. https://doi.org/10.1038/s41598-021-89747-7 .

Wu YJ, Liu S, Tian YQ, Fan ZJ, Zhang L, Liu SY. Screening and validation of pivotal genes in hepatitis B virus-associated hepatocellular carcinoma. Zhonghua Gan Zang Bing Za Zhi. 2023;31(8):869–76. https://doi.org/10.3760/cma.j.cn501113-20220420-00213 .

Bao J, Wu Y, Zhang K, Qi H. AC099850.3/NCAPG axis predicts poor prognosis and is associated with resistance to EGFR tyrosine-kinase inhibitors in lung adenocarcinoma. Int J Gen Med. 2022;15:6917–30. https://doi.org/10.2147/IJGM.S365695 .

Zhang W, Fang D, Li S, Bao X, Jiang L, Sun X. Construction and validation of a novel ferroptosis-related lncRNA signature to predict prognosis in colorectal cancer patients. Front Genet. 2021;12:709329. https://doi.org/10.3389/fgene.2021.709329 .

Lu J, An SG, Ma JJ, et al. Topoisomerase IIα gene as a marker for prognostic prediction of hepatocellular carcinoma: a bioinformatics analysis. Chin Med Sci J. 2022;37(4):331–9. https://doi.org/10.24920/004006 .

Tang XY, Luo ZL, Xiong YL, et al. The proliferative role of immune checkpoints in tumors: double regulation. Cancers (Basel). 2022;14(21):5374. https://doi.org/10.3390/cancers14215374 .

Li R, Zatloukalova P, Muller P, et al. The MDM2 ligand Nutlin-3 differentially alters expression of the immune blockade receptors PD-L1 and CD276. Cell Mol Biol Lett. 2020;25:41. https://doi.org/10.1186/s11658-020-00233-w .

Liu Y, Veeraraghavan V, Pinkerton M, et al. Viral biomarkers for hepatitis B virus-related hepatocellular carcinoma occurrence and recurrence. Front Microbiol. 2021;12:665201. https://doi.org/10.3389/fmicb.2021.665201 .

Qu S, Jin L, Huang H, Lin J, Gao W, Zeng Z. A positive-feedback loop between HBx and ALKBH5 promotes hepatocellular carcinogenesis. BMC Cancer. 2021;21(1):686. https://doi.org/10.1186/s12885-021-08449-5 .

Shi M, Li YY, Xu RN, et al. Mesenchymal stem cell therapy in decompensated liver cirrhosis: a long-term follow-up analysis of the randomized controlled clinical trial. Hepatol Int. 2021;15(6):1431–41. https://doi.org/10.1007/s12072-021-10199-2 .

Zhang L, Chen J, Jiang H, et al. MR elastography as a biomarker for prediction of early and late recurrence in HBV-related hepatocellular carcinoma patients before hepatectomy. Eur J Radiol. 2022;152: 110340. https://doi.org/10.1016/j.ejrad.2022.110340 .

Magrin L, Fanale D, Brando C, et al. POLE, POLD1, and NTHL1: the last but not the least hereditary cancer-predisposing genes. Oncogene. 2021;40(40):5893–901. https://doi.org/10.1038/s41388-021-01984-2 .

Tian Y, Ma J, Jing X, et al. Radiation therapy for extensive-stage small-cell lung cancer in the era of immunotherapy. Cancer Lett. 2022;541: 215719. https://doi.org/10.1016/j.canlet.2022.215719 .

Simó-Perdigó M, Vercher-Conejero JL, Viteri S, García-Velloso MJ. Immunotherapy, cancer and PET. Inmunoterapia, cáncer y PET. Rev Esp Med Nucl Imagen Mol (Engl Ed). 2021;40(2):123–35. https://doi.org/10.1016/j.remn.2021.02.001 .

Meng F, Zhao J, Tan AT, et al. Immunotherapy of HBV-related advanced hepatocellular carcinoma with short-term HBV-specific TCR expressed T cells: results of dose escalation, phase I trial. Hepatol Int. 2021;15(6):1402–12. https://doi.org/10.1007/s12072-021-10250-2 .

Zhang J, Hu C, Xie X, Qi L, Li C, Li S. Immune checkpoint inhibitors in HBV-caused hepatocellular carcinoma therapy. Vaccines (Basel). 2023;11(3):614. https://doi.org/10.3390/vaccines11030614 .

Shao D, Li Y, Wu J, et al. An m6A/m5C/m1A/m7G-related long non-coding RNA signature to predict prognosis and immune features of glioma. Front Genet. 2022;13:903117. https://doi.org/10.3389/fgene.2022.903117 .

Liu P, Zhou L, Chen H, He Y, Li G, Hu K. Identification of a novel intermittent hypoxia-related prognostic lncRNA signature and the ceRNA of lncRNA GSEC/miR-873–3p/EGLN3 regulatory axis in lung adenocarcinoma. PeerJ. 2023;11:e16242. https://doi.org/10.7717/peerj.16242 .

Zhang Q, Cheng M, Fan Z, Jin Q, Cao P, Zhou G. Identification of cancer cell stemness-associated long noncoding RNAs for predicting prognosis of patients with hepatocellular carcinoma. DNA Cell Biol. 2021;40(8):1087–100. https://doi.org/10.1089/dna.2021.0282 .

Mahaling B, Baruah N, Ahamad N, Maisha N, Lavik E, Katti DS. A non-invasive nanoparticle-based sustained dual-drug delivery system as an eyedrop for endophthalmitis. Int J Pharm. 2021;606: 120900. https://doi.org/10.1016/j.ijpharm.2021.120900 .

Cancer Genome Atlas Research Network. Electronic address: [email protected]; Cancer Genome Atlas Research Network. Comprehensive and Integrative Genomic Characterization of Hepatocellular Carcinoma. Cell. 2017;169(7):1327–1341.e23. https://doi.org/10.1016/j.cell.2017.05.046 .

Gu X, Li S, Ma X, Huang D, Li P. Heterogeneity characterization of hepatocellular carcinoma based on the sensitivity to 5-fluorouracil and development of a prognostic regression model. Front Pharmacol. 2023;14:1252805. https://doi.org/10.3389/fphar.2023.1252805 .

Li W, Zhao B, Wang Q, Lu J, Wu X, Chen X. Integrated analysis of tumour-derived exosome-related immune genes to predict progression and immune status of hepatocellular carcinoma. Clin Immunol. 2023;256: 109774. https://doi.org/10.1016/j.clim.2023.109774 .

Lin XH, Li DP, Liu ZY, et al. Six immune-related promising biomarkers may promote hepatocellular carcinoma prognosis: a bioinformatics analysis and experimental validation. Cancer Cell Int. 2023;23(1):52. https://doi.org/10.1186/s12935-023-02888-9 .

Zheng GL, Zhang GJ, Zhao Y, Zheng ZC. Screening protein prognostic biomarkers for stomach adenocarcinoma based on the cancer proteome atlas. Front Oncol. 2022;12:901182. https://doi.org/10.3389/fonc.2022.901182 .

Wen YD, Zhu XS, Li DJ, Zhao Q, Cheng Q, Peng Y. Proteomics-based prognostic signature and nomogram construction of hypoxia microenvironment on deteriorating glioblastoma (GBM) pathogenesis. Sci Rep. 2021;11(1):17170. https://doi.org/10.1038/s41598-021-95980-x .

Zheng H, Liu H, Li H, Dou W, Wang X. Weighted gene co-expression network analysis identifies a cancer-associated fibroblast signature for predicting prognosis and therapeutic responses in gastric cancer. Front Mol Biosci. 2021;8:744677. https://doi.org/10.3389/fmolb.2021.744677 .

Tao C, Huang K, Shi J, Hu Q, Li K, Zhu X. Genomics and prognosis analysis of epithelial-mesenchymal transition in glioma. Front Oncol. 2020;10:183. https://doi.org/10.3389/fonc.2020.00183 .

Jiang L, Zhang M, Wu J, et al. Exploring diagnostic m6A regulators in endometriosis. Aging (Albany NY). 2020;12(24):25916–38. https://doi.org/10.18632/aging.202163 .

Newman AM, Liu CL, Green MR, et al. Robust enumeration of cell subsets from tissue expression profiles. Nat Methods. 2015;12(5):453–7. https://doi.org/10.1038/nmeth.3337 .

Ali HR, Chlon L, Pharoah PD, Markowetz F, Caldas C. Patterns of Immune infiltration in breast cancer and their clinical implications: a gene-expression-based retrospective study. PLoS Med. 2016;13(12):e1002194. https://doi.org/10.1371/journal.pmed.1002194 .

Kan A, Liu S, He M, et al. MZF1 promotes tumour progression and resistance to anti-PD-L1 antibody treatment in hepatocellular carcinoma. JHEP Rep. 2023;6(1):100939. https://doi.org/10.1016/j.jhepr.2023.100939 .

Zhu Y, Tan JK, Goon JA. Cuproptosis- and m6A-related lncRNAs for prognosis of hepatocellular carcinoma. Biology (Basel). 2023;12(8):1101. https://doi.org/10.3390/biology12081101 .

Du Y, Miao W, Jiang X, et al. The epithelial to mesenchymal transition related gene calumenin is an adverse prognostic factor of bladder cancer correlated with tumor microenvironment remodeling, gene mutation, and ferroptosis [published correction appears in Front Oncol. 2023 May 11;13:1185029. 10.3389/fonc.2023.1185029]. Front Oncol. 2021;11:683951. https://doi.org/10.3389/fonc.2021.683951 .

He H, Zhou J, Cheng F, Li H, Quan Y. MiR-3677-3p promotes development and sorafenib resistance of hepatitis B-related hepatocellular carcinoma by inhibiting FOXM1 ubiquitination. Hum Cell. 2023;36(5):1773–89. https://doi.org/10.1007/s13577-023-00945-z .

Zhao K, Zhang Y, Kang L, et al. Methylation of microRNA-129–5P modulates nucleus pulposus cell autophagy by targeting Beclin-1 in intervertebral disc degeneration. Oncotarget. 2017;8(49):86264–76. https://doi.org/10.18632/oncotarget.21137 .

Gao W, Shen R. Nanogel enhances the efficacy of MLN8237 in treating hepatocellular carcinoma. J Biomater Appl. 2023;38(4):527–37. https://doi.org/10.1177/08853282231202326 .

Zhu G, Cheng Z, Huang Y, et al. MyD88 mediates colorectal cancer cell proliferation, migration and invasion via NF-κB/AP-1 signaling pathway. Int J Mol Med. 2020;45(1):131–40. https://doi.org/10.3892/ijmm.2019.4390 .

Liu P, Jia SB, Shi JM, et al. LncRNA-MALAT1 promotes neovascularization in diabetic retinopathy through regulating miR-125b/VE-cadherin axis. Biosci Rep. 2019;39(5):BSR20181469. https://doi.org/10.1042/BSR20181469 .

Liu R, Guo H, Lu S. MiR-335-5p restores cisplatin sensitivity in ovarian cancer cells through targeting BCL2L2. Cancer Med. 2018;7(9):4598–609. https://doi.org/10.1002/cam4.1682 .

Pan X, Hong X, Li S, Meng P, Xiao F. METTL3 promotes adriamycin resistance in MCF-7 breast cancer cells by accelerating pri-microRNA-221-3p maturation in a m6A-dependent manner. Exp Mol Med. 2021;53(1):91–102. https://doi.org/10.1038/s12276-020-00510-w .

Saraswati S, Alhaider A, Abdelgadir AM, Tanwer P, Korashy HM. Phloretin attenuates STAT-3 activity and overcomes sorafenib resistance targeting SHP-1-mediated inhibition of STAT3 and Akt/VEGFR2 pathway in hepatocellular carcinoma. Cell Commun Signal. 2019;17(1):127. https://doi.org/10.1186/s12964-019-0430-7 .

Ke M, Zhang Z, Xu B, et al. Baicalein and baicalin promote antitumor immunity by suppressing PD-L1 expression in hepatocellular carcinoma cells. Int Immunopharmacol. 2019;75: 105824. https://doi.org/10.1016/j.intimp.2019.105824 .

Maranda G, Gagnon D. Les blessures par arme à feu: évaluation et traitement [Gunshot wounds: evaluation and treatment]. J Dent Que. 1987;24:337–40.

PubMed   CAS   Google Scholar  

Wang X, Wu Y. Protective effects of autophagy inhibitor 3-methyladenine on ischemia-reperfusion-induced retinal injury. Int Ophthalmol. 2020;40(5):1095–101. https://doi.org/10.1007/s10792-019-01272-9 .

Download references

Acknowledgements

This study was supported by the Postgraduate Innovation Special Foundation of Jiangxi province (YC2021-B053) and Clinical Research Program for The Second Affiliated Hospital of Nanchang University (2021efyB04).

Author information

Aoxiao He and Zhihao Huang are co-first authors.

Authors and Affiliations

Department of General Surgery, The Second Affiliated Hospital, Jiangxi Medical College, Nanchang University, No. 1, Minde Road, Nanchang, 330006, China

Aoxiao He, Zhihao Huang, Hongcheng Lu & Jiakun Wang

Department of Emergency, The Second Affiliated Hospital, Jiangxi Medical College, Nanchang University, Nanchang, 330006, China

Department of Hematology, The Second Affiliated Hospital, Jiangxi Medical College, Nanchang University, Nanchang, 330006, China

Department of Gastroenterology, The Second Affiliated Hospital, Jiangxi Medical College, Nanchang University, Nanchang, 330006, China

Fan Li & Dan Li

You can also search for this author in PubMed   Google Scholar

Contributions

A.H. and Z.H. conceived and designed the study. Q.F. conducted data analysis. S.Z. and F.L. performed the experiments. D.L. and H.L. contributed to the writing of the manuscript. J.W. supervised the overall study. All authors reviewed and approved the final version of the manuscript.

Corresponding authors

Correspondence to Hongcheng Lu or Jiakun Wang .

Ethics declarations

Ethics approval and consent to participate.

All animal experiments were approved by the Animal Ethics Committee of The Second Affiliated Hospital of Nanchang University.

Consent for publication

Not applicable.

Competing interests

The author declares no conflict of interest.

Additional information

Publisher's note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

12967_2024_5576_moesm1_esm.pdf.

Additional file 1: Figure S1. Construction process of HBV-HCC prognostic model: WGCNA analysis, Lasso regression analysis, and survival analysis.Dendrogram of clustering analysis performed by WGCNA on all samples;Scale-free fitting index and average connectivity analysis for different soft thresholds;WGCNA analysis divides genes into different gene modules and provides clustering results;Cross-validation plot of Lasso regression analysis;Kaplan–Meier survival curve for high-risk and low-risk groups based on training set;Kaplan–Meier survival curve for high-risk and low-risk groups based on testing set.

12967_2024_5576_MOESM2_ESM.pdf

Additional file 2: Figure S2. ROC curve analysis and survival status analysis during the construction process of the HBV-HCC prognostic model.ROC curve analysis based on the training set to evaluate the predictive value of the high-risk and low-risk groups in HBV-HCC diagnosis;ROC curve analysis based on the testing set to evaluate the predictive value of the high-risk and low-risk groups in HBV-HCC diagnosis;Risk curve and patient survival status for the high-risk and low-risk groups based on the training set;Heatmap showing the expression of the six model genes in the high-risk and low-risk groups based on the training set;Risk curve and patient survival status for the high-risk and low-risk groups based on the testing set;Heatmap showing the expression of the six model genes in the high-risk and low-risk groups based on the testing set; High-risk group in the training set: 11 samples; Low-risk group in the training set: 9 samples; High-risk group in the testing set: 12 samples; Low-risk group in the testing set: 12 samples.

12967_2024_5576_MOESM3_ESM.pdf

Additional file 3: Figure S3. Analysis of the expression levels of model genes and their correlation with immune cells.Differential levels of gene AC012313.9 between 50 normal samples and 44 HBV-HCC samples, AC012313.9, MIR210HG, AL645933.2, C6orf223, GDF10;Correlation analysis between significantly different immune cell components and the expression levels of AC099850.3, with AC099850.3 expression on the x-axis and immune cell content on the y-axis, Dendritic cells resting, T cells follicular helper, and T cells gamma delta;Scatter plot showing the correlation between AC099850.3 and tumor mutation burden; "ns" indicates no significant difference between the groups compared; ** indicates a comparison between the groups with a P value < 0.01; *** indicates a comparison between the groups with a P value < 0.001.

Additional file 4: Figure S4. A scatter plot shows the top 6 genes ranked by correlation with AC099850.3.

12967_2024_5576_moesm5_esm.pdf.

Additional file 5: Figure S5 . In vivo tumor uptake test and toxicity evaluation of NPs.Bioluminescence and Cy5 fluorescence images of mice in each group;Composite images of organs from mice in each group, with white dashed lines indicating the direction and approximate location of the slices;Fluorescence images of tumor slices from mice in each group;Histological analysis of heart, liver, spleen, lung, and kidney tissues from mice in each group; N = 5.

Additional file 6.

Rights and permissions.

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/ .

Reprints and permissions

About this article

Cite this article.

He, A., Huang, Z., Feng, Q. et al. AC099850.3 promotes HBV-HCC cell proliferation and invasion through regulating CD276: a novel strategy for sorafenib and immune checkpoint combination therapy. J Transl Med 22 , 809 (2024). https://doi.org/10.1186/s12967-024-05576-y

Download citation

Received : 08 May 2024

Accepted : 04 August 2024

Published : 31 August 2024

DOI : https://doi.org/10.1186/s12967-024-05576-y

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Hepatitis B virus-related hepatocellular carcinoma
• Cell proliferation and invasion
• Nanoparticles
• Combined therapy

Journal of Translational Medicine

ISSN: 1479-5876

• Submission enquiries: Access here and click Contact Us
• General enquiries: [email protected]