case study questions 12 biology

Case Study Based Questions for CBSE Class 12 Biology Board Exam 2024: Read this article for Last Minute Revision

Cbse class 12 biology important case study questions : practise important case study based questions for class 12 biology board exam. these case study based questions are important for the upcoming cbse class 12 biology board exam 2024 on march 19, 2024..

CBSE Class 12th Biology Board Exam 2023-24 Pattern

The paper will be of 70 marks and the time duration for completing the paper will be 3 hours.

The paper will have 33 questions divided into 5 sections.

Section–A 16 questions of 1 mark each,

Section–B 5 questions of 2 marks each;

Section–C 7 questions of 3 marks each;

Section–D 2 case-based questions of 4 marks each,

and Section–E 3 questions of 5 marks each.

CBSE Class 12 Biology Important Case Study Based Questions

Case Study 1:  Nondisjunction is the failure of homologous chromosomes to disjoin correctly during meiosis. It leads to the formation of a new cell with an abnormal amount of genetic material. A number of clinical conditions are the result of this type of chromosomal mutation. This results in the production of gametes containing a greater or lesser chromosomal amount than normal ones. Consequently, the individual may develop a trisomy or monosomal syndrome. Nondisjunction can occur in both Meiosis I and Meiosis II of the cellular division. It is also the main cause of many genetic disorders; however, its origin and process remain vague. Although it results in the majority of cases from errors in maternal meiosis II, both paternal and maternal meiosis I do influence it. Maternal age is considered a risk factor for trisomy, as well as recombination alterations and many others that can affect chromosomal segregation.

• It is the presence of an extra chromosome in a diploid cell.
• An aneuploid cell differs from other cells only in size.
• It can be less number of chromosomes in a diploid cell.
• Aneuploidy always affects female individuals.
• both i and iii
• both ii and iii
• i, iii and iv
• Errors in meiosis I is the only cause of aneuploidy
• Aneuploidy always affects sex chromosomes.
• Most of the aneuploidy results from errors in cell division involved in egg formation.
• Nondisjunction in meiosis I can lead to more abnormal cells than disjunction in meiosis II.
• both I and iii
• both iii and iv
• I, iii and iv
• Aneuploidy is not influenced by the mother’s age.
• Delivery before 30 years of age can decrease the incidence of aneuploidy in most cases
• The chance of aneuploidy increases up to 22 years of age.
• There is a dramatic increase in aneuploidy if the maternal age exceeds 30

• both ii and iv
• Chromosomal disorders
• Mendelian disorders
• Incomplete dominance
• All the above

Q5: Assertion: All types of genetic disorders are caused by chromosomal nondisjunction.

• Both assertion and reason are correct and the reason is the correct explanation of assertion
• Both assertion and reason are correct but the reason is not the correct explanation of the assertion
• Assertion is correct but the reason is incorrect
• Both assertion and reason are incorrect

Case Study 2:  A Representative Diagram of the Human Genome Project:

• Biotechnology
• Biomonitoring
• Bioinformatics
• Biosystematics

Q2:  Name a free living, non-pathogenic nematode, the DNA of which has been completely sequenced.

Answer: Caenorhabditis elegans

Q3: Summarize the methodology adopted in the Human Genome Project.

Answer: Expressed Sequence Tags (ESTs) : The approach focused on identifying all the genes that are expressed as RNA.

Sequence Annotation : The other took the blind approach of simply sequencing the whole set of genome that contained all the coding and non-coding sequence, and later assigning different regions in the sequence with functions.

Q4: What are SNPs’? How are they useful in human genomics?

• Identify disease-causing genes in humans
• Can be used to understand the molecular mechanisms of sequence evolution.

Q5: Mention at least four salient features of the Human Genome Project.

• Human genome contains 3164.7 million bp.
• Average gene consists of 3000 bases, but sizes vary greatly.
• Almost all (99.9 percent) nucleotide bases are exactly the same in all people.
• Less than 2 percent of the genome codes for proteins.

Case Study 3: Two blood samples of suspects ‘A’ and ‘B’ were sent to the Forensic Department along with sample ‘C’ from the crime scene. The Forensic Department was assigned the responsibility of running the samples and matching the samples of the suspects with that of the sample from the scene of the crime and thereby identifying the culprit.

• A radioactively labelled double stranded RNA molecule.
• A radioactively labelled double stranded DNA molecule.
• A radioactively labelled single stranded DNA molecule.
• A radioactively labelled single stranded RNA molecule.

Q3: What does ‘minisatellite’ and ‘microsatellite’ mean in relation to DNA Fingerprinting?

Answer:  Minisatellite: the repeating unit consists of 10-100 base pairs.

Microsatellite: the repeating unit consists of 2-6 base pairs.

Q3: How does polymorphism arise in a population?

Answer: Polymorphism (variation at the genetic level) arises due to mutations.

Q4: State the steps involved in DNA Fingerprinting in a sequential manner.

• DNA isolation
• DNA digestion with restriction enzymes.
• DNA fragment separation by electrophoresis.
• Hybridization
• DNA visualization under UV light.

Case Study 4: Bacteria like Streptococcus pneumoniae  and Haemophilus influenzae  are responsible for the disease pneumonia in humans which infects the alveoli (air-filled sacs) of the lungs. As a result of the infection, the alveoli get filled with fluid leading to severe problems in respiration. The symptoms of pneumonia include fever, chills, cough, and headache. In severe cases, the lips and fingernails may turn gray to bluish in colour. A healthy person acquires the infection by inhaling the droplets/aerosols released by an infected person or even by sharing glasses and utensils with an infected person. Dysentery, plague, diphtheria, etc., are some of the other bacterial diseases in man. Many viruses also cause diseases in human beings. Rhinoviruses represent one such group of viruses that cause one of the most infectious human ailments – the common cold. They infect the nose and respiratory passage but not the lungs.

The common cold is characterized by nasal congestion and discharge, sore throat, hoarseness, cough,

headache, tiredness, etc., which usually lasts for 3-7 days. Droplets resulting from the cough or sneezes of an infected person are either inhaled directly or transmitted through contaminated objects such as pens, books, cups, doorknobs, computer keyboards or mice, etc., and cause infection in a healthy person.

• By exhaling droplets of a non-infected person.
• By headache or leg pain.
• By eating fast food.
• By inhaling droplets of an infected person.

Q4:  How long does the common cold last?

Answer: 3-7 days

Q5:  Write any two symptoms of the common cold and pneumonia.

Answer: Cough and nasal congestion.

Case Study 5: When you insert a piece of alien DNA into a cloning vector and transfer it into a bacterial, plant, or animal cell, the alien DNA gets multiplied. In almost all recombinant technologies, the ultimate aim is to produce a desirable protein. Hence, there is a need for the recombinant DNA to be expressed. The foreign gene gets expressed under appropriate conditions. The expression of foreign genes in host cells involves understanding many technical details. After having cloned the gene of interest and having optimised the conditions to induce the expression of the target protein, one has to consider producing it on a large scale. Can you think of any reason why there is a need for large-scale production? If any protein encoding gene is expressed in a heterologous host, it is called a recombinant protein. The cells harbouring cloned genes of interest may be grown on a small scale in the laboratory. The cultures may be used for extracting the desired protein and then purifying it by using different separation techniques.

• A continuous culture system
• A stirred-tank bioreactor without in-lets and out-lets
• Laboratory flask of the largest capacity
• None of the above
• upstream processing
• downstream processing
• bioprocessing
• postproduction processing
• Human insulin
• Growth hormone
• cleaving and joining of DNA segments with endonuclease
• cleaving DNA segments with endonuclease and re-joining with ligase
• cleaving and re-joining DNA segments with ligase
• cleaving DNA segments with ligase and re-joining with endonuclease

Case Study 6: Gene Therapy

Read the following and answer the questions that follow:

• Replacing a disease-causing gene with a healthy copy of the gene
• Inactivating a disease-causing gene that is not functioning properly
• Introducing a new or modified gene into the body to help treat a disease
• Adenosine deaminase
• phenylketonuria
• Phenylalanine
• Bone marrow transplantation
• Southern blotting

Q4 Introduction of gene isolate from bone marrow producing ADA should be introduced at what age to

• acute diseases
• physiological diseases
• hereditary diseases
• infectious diseases
• CBSE Class 12 Biology Previous Year Question Papers with Solutions PDF Download
• CBSE Class 12 Syllabus 2023-24 PDF (All Subjects)
• CBSE Class 12 Deleted Syllabus (All Subjects)
• CBSE Class 12 Previous Year Papers with Solution PDF Download
• CBSE Class 12 Additional Practice Questions
• CBSE Class 12 Sample Paper 2023-24 with Solution and Additional Practice Questions
• Important MCQs for CBSE Class 12 Biology, All Chapters
• CBSE Class 12 Biology Mind Maps for Quick Revision
• CBSE Class 12 NCERT Biology Revised Textbook PDF
• CBSE Class 12 NCERT Biology Solutions
• CBSE Class 12 Biology Chapter-wise notes
• CBSE Class 12 Date Sheet 2024
• CBSE Competency Based Questions 2023-24
• CBSE Class 12 Additional Practice Questions 2024

Get here latest School , CBSE and Govt Jobs notification and articles in English and Hindi for Sarkari Naukari , Sarkari Result and Exam Preparation . Download the Jagran Josh Sarkari Naukri App .

• CBSE Board exam 2023 result date. + As per the guidelines released by the Central Board of Secondary Education (CBSE), the tentative dates for the CBSE Board Exam 2023 results are; for class 10th: 15th April 2023 and for class 12th: 30th April 2023.
• When is the Class 12th Biology CBSE Board exam? + According to the date sheet released by the Central Board of Secondary Education (CBSE) for class 12th, the Biology exam is scheduled for the 16th of March 2023. The day will be Thursday.
• SSC MTS Exam Date 2024
• UGC NET Admit Card 2024
• Har Ghar Tiranga Campaign UPSC
• UGC NET City Intimation Slip 2024
• UP Police Constable Mock Test
• Independence Day Poems
• Independence Day Speech in Hindi
• Independence Day Drawing
• Independence Day Speech
• India Post GDS Cut Off
• Education News
• CBSE Class 10

Latest Education News

India Independence Day 2024: 70+ Quotes, Wishes, Messages, Greetings to Wish Your Friends and Family

IQ Test: Find 525 among 555’s in 5 seconds!

Happy Independence 2024: 50+ Images, Photos and Pictures to Share with Friends and Family

OSSSC Forest Guard Final Revised Answer Key 2024 OUT at osssc.gov.in: Download Here

Viksit Bharat: How Technology Has Transformed Modern India

Optical Illusion: Only hawk eyes can find the hidden frog in 7 seconds!

Independence Day 2024 Quiz: Do you know these basic questions about India?

RRC NR Recruitment 2024 for 4096 Apprentice Posts, Apply Online at rrcnr.org

UPSC Full Form with Complete Details

UP Police Exam City Slip 2024 Soon at uppbpb.gov.in: Check UPPRPB Constable Admit Card Updates

The Evolution of India's Foreign Policy Since 1947

RRB NTPC Syllabus 2024: आरआरबी एनटीपीसी परीक्षा का सिलेबस और एग्जाम पैटर्न यहाँ देखें

CCSU Result 2024 OUT at ccsuniversity.ac.in; Direct Link to Download Even Semester UG and PG Marksheet

Independence Day 2024: स्वतंत्रता दिवस पर यहां देखें आकर्षक नारें और कैप्शन

Independence Day 2024: स्वतंत्रता दिवस पर इस प्रकार दे सकते हैं अच्छा भाषण, देखें सैंपल

NEET PG Exam Analysis 2024: Check Shift 1 and Shift 2 Question Paper Review, Difficulty Level, Good Attempts

उत्तर प्रदेश के 10 सबसे बड़े जिले, यहां देखें लिस्ट

Independence Day Special: किस पीएम को लाल किले से तिरंगा फहराने का नहीं मिला था मौका? जानें

APSU Result OUT at apsurewa.ac.in; Check Direct Link to Download UG and PG Marksheet Here

India Independence Day 2024: What, When, Why, Where & How Of Indian Freedom Struggle

CBSE Expert

CBSE Class 12 Biology Case Study Questions PDF Download

Welcome to the comprehensive guide on CBSE Class 12 Biology Case Study Questions! In this article, we will delve into the world of Biology case studies, explore the importance of case study questions, and provide you with a PDF download that will assist you in mastering this subject. Whether you’re a student preparing for your examinations or a teacher looking to enhance your teaching materials, our detailed resource will help you excel in the realm of Biology.

Case studies are a widely used educational tool that involves the in-depth analysis of a particular situation, organism, process, or problem. In CBSE Class 12 Biology, case study questions are designed to evaluate students’ critical thinking, problem-solving abilities, and practical application of biological concepts. These questions require students to apply their theoretical knowledge to real-life scenarios, thus fostering a deeper understanding of the subject matter.

Class 12 Biology Case Study Questions

CBSE Class 12 Biology question paper will have case study questions too. These case-based questions will be objective type in nature. So, Class 12 Biology students must prepare themselves for such questions. First of all, you should study NCERT Textbooks line by line, and then you should practice as many questions as possible.

Chapter-wise Solved Case Study Questions for Class 12 Biology

Class 12 students should go through important Case Study problems for Biology before the exams. This will help them to understand the type of Case Study questions that can be asked in Grade 12 Biology examinations. Our expert faculty for standard 12 Biology have designed these questions based on the trend of questions that have been asked in last year’s exams. The solutions have been designed in a manner to help the grade 12 students understand the concepts and also easy-to-learn solutions.

Books for Class 12 Biology

Strictly as per the new term-wise syllabus for Board Examinations to be held in the academic session 2022-23 for class 12 Multiple Choice Questions based on new typologies introduced by the board- Stand-Alone MCQs, MCQs based on Assertion-Reason Case-based MCQs. Include Questions from CBSE official Question Bank released in April 2022 Answer key with Explanations What are the updates in the book: Strictly as per the Term wise syllabus for Board Examinations to be held in the academic session 2022-23. Chapter-wise -Topic-wise Multiple choice questions based on the special scheme of assessment for Board Examination for Class 12th.

Tips to Excel in CBSE Class 12 Biology Case Study Questions

Thoroughly grasp the concepts.

Before attempting case study questions, ensure you have a strong grasp of fundamental biological concepts. Familiarize yourself with topics such as genetics, ecology, human physiology, and evolution. A solid foundation will empower you to tackle complex case studies with confidence.

Practice Regularly

Practice makes perfect, and this is especially true for case study questions. Allocate time to work through a diverse range of case studies regularly. Familiarizing yourself with different scenarios will prepare you for the unpredictability of examination questions.

Collaborate and Discuss

Engaging in group discussions with fellow students or teachers can be highly beneficial. Sharing perspectives, analyzing cases together, and discussing possible solutions can broaden your understanding and offer fresh insights.

Seek Guidance from Teachers

Don’t hesitate to approach your teachers for assistance. They possess valuable experience and expertise to guide you through challenging case studies and provide valuable feedback.

Time Management

During examinations, time management is crucial. Practice solving case study questions under timed conditions to improve your efficiency and ensure you complete all questions within the allocated timeframe.

In conclusion, mastering case study questions in CBSE Class 12 Biology is essential for a holistic understanding of the subject and for excelling in examinations. By honing your analytical abilities, practicing regularly, and seeking guidance, you can conquer even the most challenging case studies. Remember that learning Biology is not just about memorizing facts but about applying knowledge to real-world situations. So, embrace the power of case studies and delve into the fascinating world of Biology.

With the provided CBSE Class 12 Biology Case Study Questions PDF, you have a valuable resource at your disposal. Practice diligently, and you’ll witness your confidence soar as you become a proficient problem solver in the realm of Biology. Good luck on your academic journey!

Leave a Comment Cancel reply

Save my name, email, and website in this browser for the next time I comment.

Download India's best Exam Preparation App Now.

Key Features

• Revision Notes
• Important Questions
• Previous Years Questions
• Case-Based Questions
• Assertion and Reason Questions

No thanks, I’m not interested!

myCBSEguide

• Class 12 Biology Case...

Class 12 Biology Case Study Questions

Table of Contents

myCBSEguide App

Download the app to get CBSE Sample Papers 2023-24, NCERT Solutions (Revised), Most Important Questions, Previous Year Question Bank, Mock Tests, and Detailed Notes.

As we know that CBSE will now ask case study questions in each subject. In most of the cases, we have noticed that these case-based questions are high-scoring. A little effort on these case study questions can help you get good marks in your board exams. You can download CBSE Class 12 Biology Case Study Questions from the myCBSEguide App or from our Student Dashboard .

Let’s understand what type of case study questions CBSE asks in class 12 Biology. If you analyze the latest class 12 Biology sample papers , you will find that there are two types of case study questions in the Biology question papers.

• Case Studies with objective questions
• Case studies with subjective questions

As per the latest circular issued by CBSE on Assessment and Evaluation Practices of the Board for the Session 2022-23 , CBSE has clearly mentioned that competency-based questions including case studies will be different from subjective questions. Hence, we expect that CBSE will ask only objective questions in CBSE class 12 Biology case study questions too.

Biology Competency Based Questions

As discussed earlier too, the competency-based questions promote learning development for our students and test higher-order skills, such as analysis, critical thinking and conceptual clarity. Case study questions are actually competency-based questions. The very purpose of including such questions in the curriculum is to emphasise on development of problem-solving ability and the ability to apply knowledge in real-life situations.

Even in CBSE Class 12 Biology case studies, you will find some text input like paragraphs, pictures, data etc followed by some objective-type questions. You should read the given information carefully and then answer the questions.

CBSE 12th Biology Case Study MCQs

Here is one example question on subjective type case study questions. This was given in the term-2 sample paper in 2022.

Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single-stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.

• What is the objective of this action?
• Explain how the gene of interest is introduced into a vector.
• You are given the DNA shown below. 5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.
• A gene M was introduced into E.coli cloning vector PBR322 at the BamH1 site. What will be its impact on the recombinant plasmids? Give a possible way by which you could differentiate non-recombinant to recombinant plasmids.

Let’s take another example from MCQ type question:

To answer the questions, study the graphs below for Subject-1 and 2 showing different levels of certain hormones.

The peak observed in Subject-1 and 2 is due to

• progesterone
• luteinizing hormone
• follicle stimulating hormone

Subject 2 has higher level of hormone B, which is

If the peak of Hormone A does not appear in the study for Subject 1, which of the following statement is true?

• Peak of Hormone B will be observed at a higher point in the graph
• Peak of Hormone B will be observed at a point lower than what is given in the graph
• There will be no observed data for Hormone B
• The graph for Hormone B will be a sharp rise followed by a plateau

Which structure in the ovary will remain functional in subject 2?

• Corpus Luteum
• Tertiary follicle
• Graafian follicle
• Primary follicle

For subject 2 it is observed that the peak for hormone B has reached the plateau stage. After approximately how much time will the curve for hormone B descend?

Which of the following statements is true about the subjects?

• Subject 1 is pregnant
• Subject 2 is pregnant
• Both subject 1 and 2 are pregnant
• Both subject 1 and 2 are not pregnant

Another example of a class 12 Biology case study question

We use microbes or products which are derived from them every day. A common example is the production of curd from milk. Micro-organisms such as Lactobacillus and others commonly called lactic acid bacteria (LAB) grow in milk and convert it to curd. The dough, which is used for making foods such as dosa and idli is also fermented by bacteria. A number of traditional drinks and foods are also made by fermentation by microbes.  ‘Toddy’, a traditional drink in some parts of southern India is made by fermenting sap from palms. The ‘Roquefort cheese’ is ripened by growing specific fungi on them, which gives them a particular flavour. Different varieties of cheese are known by their characteristic texture, flavour and taste, the specificity coming from the microbes used.

• Penicillium notatum
• Saccharomyces cerevisiae
• Aspergillus niger
• Clostridium butylicum
• thermal vents
• polluted water
• all of these
• None of the above
• production of a large amount of CO 2
• production of O 2
• due to the presence of water
• none of these
• Both Assertion and Reason are true and Reason is the correct explanation of the Assertion
• Both Assertion and Reason are true but Reason is not the correct explanation of the Assertion
• Our Assertion is true but the Reason is false
• Both the statements are false

Download 12 Biology Case Study Questions

In this article, we have given you a few examples of class 12 Biology case study questions. We advise you to download the myCBSEguide App or access our Student Dashboard to get more case study questions for CBSE class 12 biology. We have hundreds of questions on case studies related to CBSE Class 12 Biology. As CBSE is now focusing more on the understanding of the concepts, it is a must for students to practice such questions regularly.

Test Generator

Create question paper PDF and online tests with your own name & logo in minutes.

Question Bank, Mock Tests, Exam Papers, NCERT Solutions, Sample Papers, Notes

Related Posts

• Competency Based Learning in CBSE Schools
• Class 11 Physical Education Case Study Questions
• Class 11 Sociology Case Study Questions
• Class 12 Applied Mathematics Case Study Questions
• Class 11 Applied Mathematics Case Study Questions
• Class 11 Mathematics Case Study Questions
• Class 11 Biology Case Study Questions
• Class 12 Physical Education Case Study Questions

Leave a Comment

Save my name, email, and website in this browser for the next time I comment.

• New QB365-SLMS
• 12th Standard Materials
• 11th Standard Materials
• 10th Standard Materials
• 9th Standard Materials
• 8th Standard Materials
• 7th Standard Materials
• 6th Standard Materials
• 12th Standard CBSE Materials
• 11th Standard CBSE Materials
• 10th Standard CBSE Materials
• 9th Standard CBSE Materials
• 8th Standard CBSE Materials
• 7th Standard CBSE Materials
• 6th Standard CBSE Materials
• Tamilnadu Stateboard
• Scholarship Exams
• Scholarships

CBSE 12th Standard Biology Subject Human Reproduction Case Study Questions With Solution 2021

By QB365 on 21 May, 2021

QB365 Provides the updated CASE Study Questions for Class 12 Biology, and also provide the detail solution for each and every case study questions . Case study questions are latest updated question pattern from NCERT, QB365 will helps to get  more marks in Exams

QB365 - Question Bank Software

12th Standard CBSE

Final Semester - June 2015

Case Study Questions

(ii) Identify the correctly matched pair.

(iii) Which statement is incorrect for Q?

(iv) Which structure passes through the prostate gland and carries sperms and secretion of seminal vesicle?

(v ) Assertion: Mucus present in secretion of bulbourethral gland decreases the number of sperms damaged during ejaculation Reason: Mucus lubricates the end of penis and lining of the urethra. (a) Both assertion and reason are true and reason is the correct explanation of assertion. (b) Both assertion and reason are true but reason is not the correct explanation of assertion. (c) Assertion is true but reason is false. (d) Both assertion and reason are false .

Read the following and answer any four questions from (i) to (v) given below: The first menstruation is called menarche, that usually occurs between 12 and 15 years. In human females, menstruation is repeated at an average interval of about 28129 days and is called menstrual cycle. It is regulated by certain hormones, as pituitary gland is stimulated by releasing factors produced in the hypothalamus. The hormones produced by pituitary gland influence the ovaries. The hormones secreted by the ovaries affect the walls of the uterus. (i) The breakdown of endometrium is characteristic of

(ii) Which days of the menstrual cycle marks the proliferative phase?

(iii) Which of the following occurs during secretory phase?

(iv) Identify the hormones that attain peak level during ovulatory phase

(v) Withdrawal of which hormone causes degeneration of corpus luteum?

*****************************************

Cbse 12th standard biology subject human reproduction case study questions with solution 2021 answer keys.

A. Acrosome (i) The secretions.enzymes of acrosome dissolve the egg envelopes and help the sperm enter the cytoplasm of the ovum. B. Mitochondria (i) The mitochondria in the middle piece provide energy for the sperm motility in the female reproductive tract towards ovum. C. Tail (i) It facilitates the movement of sperm towards the ovum for fertilisation.

(a) X is hormone estrogen. (i) It is secreted by the cells of the developing follicle. Y is hormone progesterone. (ii) It is secreted by corpus luteum. (b) (i) X is secreted by the cells of the follicle during follicular phase before ovulation; after the rupture of Graafian follicle, there is no secretion of estrogen. (ii) Y is secreted by corpus luteum that is formed after ovulation in the luteal phase; hence X peaks before Y.

(i) 1. Gonadotropin-releasing hormone (GnRH) 2. Follicle-stimulating hormone (FSH) and Luteinising hormone (LH) 3. Progesterone. (b) Corpus luteum secretes progesterone.

(i) (b) : P is an epididymis that stores the sperms and secretes a fluid which is considered to nourish the sperms (ii) (b) : Q - Vas deferens, R - Ejaculatory duct S - Bulbourethral gland, T - Seminal vesicle (iii) (c) : Q (vas deferens) arises from cauda epididymis (iv) (d) (v) (a)

(i) (d): During menstrual phase, the endometrium breaks down and menstruation begins. (ii) (c) : Proliferative phase extends for about 10-12 days usually from day 6th to 13th in a 28 day cycle (iii) (a) (iv) (d) : During ovulatory phase, both LH and FSH attain a peak level (v) (b)

Related 12th Standard CBSE Biology Materials

12th standard cbse syllabus & materials, cbse 12th physics wave optics chapter case study question with answers, cbse 12th physics ray optics and optical instruments chapter case study question with answers, cbse 12th physics nuclei chapter case study question with answers, cbse 12th physics moving charges and magnetism chapter case study question with answers, cbse 12th physics electromagnetic induction chapter case study question with answers, cbse 12th physics atoms chapter case study question with answers, 12th physics alternating current chapter case study question with answers cbse, 12th maths vector algebra chapter case study question with answers cbse, 12th maths three dimensional geometry chapter case study question with answers cbse, 12th maths probability chapter case study question with answers cbse, 12th maths linear programming chapter case study question with answers cbse, 12th maths differential equations chapter case study question with answers cbse, 12th maths continuity and differentiability chapter case study question with answers cbse, 12th maths application of integrals chapter case study question with answers cbse, 12th chemistry the d and f block elements chapter case study question with answers cbse.

Class VI to XII

Tn state board / cbse, 3000+ q&a's per subject, score high marks.

12th Standard CBSE Study Materials

12th Standard CBSE Subjects

• Andhra Pradesh
• Chhattisgarh
• West Bengal
• Madhya Pradesh
• Maharashtra
• Jammu & Kashmir
• NCERT Books 2022-23
• NCERT Solutions
• NCERT Notes
• NCERT Exemplar Books
• NCERT Exemplar Solution
• States UT Book
• School Kits & Lab Manual
• NCERT Books 2021-22
• NCERT Books 2020-21
• NCERT Book 2019-2020
• NCERT Book 2015-2016
• RD Sharma Solution
• TS Grewal Solution
• TR Jain Solution
• Selina Solution
• Frank Solution
• Lakhmir Singh and Manjit Kaur Solution
• I.E.Irodov solutions
• ICSE - Goyal Brothers Park
• ICSE - Dorothy M. Noronhe
• Micheal Vaz Solution
• S.S. Krotov Solution
• Evergreen Science
• KC Sinha Solution
• ICSE - ISC Jayanti Sengupta, Oxford
• ICSE Focus on History
• ICSE GeoGraphy Voyage
• ICSE Hindi Solution
• ICSE Treasure Trove Solution
• Thomas & Finney Solution
• SL Loney Solution
• SB Mathur Solution
• P Bahadur Solution
• Narendra Awasthi Solution
• MS Chauhan Solution
• LA Sena Solution
• Integral Calculus Amit Agarwal Solution
• IA Maron Solution
• Hall & Knight Solution
• Errorless Solution
• Pradeep's KL Gogia Solution
• OP Tandon Solutions
• Sample Papers
• Previous Year Question Paper
• Important Question
• Value Based Questions
• CBSE Syllabus
• CBSE MCQs PDF
• Assertion & Reason
• New Revision Notes
• Revision Notes
• Question Bank
• Marks Wise Question
• Toppers Answer Sheets
• Exam Paper Aalysis
• Concept Map
• CBSE Text Book
• Additional Practice Questions
• Vocational Book
• CBSE - Concept
• KVS NCERT CBSE Worksheets
• Formula Class Wise
• Formula Chapter Wise
• JEE Previous Year Paper
• JEE Mock Test
• JEE Crash Course
• JEE Sample Papers
• Important Info
• SRM-JEEE Previous Year Paper
• SRM-JEEE Mock Test
• VITEEE Previous Year Paper
• VITEEE Mock Test
• BITSAT Previous Year Paper
• BITSAT Mock Test
• Manipal Previous Year Paper
• Manipal Engineering Mock Test
• AP EAMCET Previous Year Paper
• AP EAMCET Mock Test
• COMEDK Previous Year Paper
• COMEDK Mock Test
• GUJCET Previous Year Paper
• GUJCET Mock Test
• KCET Previous Year Paper
• KCET Mock Test
• KEAM Previous Year Paper
• KEAM Mock Test
• MHT CET Previous Year Paper
• MHT CET Mock Test
• TS EAMCET Previous Year Paper
• TS EAMCET Mock Test
• WBJEE Previous Year Paper
• WBJEE Mock Test
• AMU Previous Year Paper
• AMU Mock Test
• CUSAT Previous Year Paper
• CUSAT Mock Test
• AEEE Previous Year Paper
• AEEE Mock Test
• UPSEE Previous Year Paper
• UPSEE Mock Test
• CGPET Previous Year Paper
• Crash Course
• Previous Year Paper
• NCERT Based Short Notes
• NCERT Based Tests
• NEET Sample Paper
• Previous Year Papers
• Quantitative Aptitude
• Numerical Aptitude Data Interpretation
• General Knowledge
• Mathematics
• Agriculture
• Accountancy
• Business Studies
• Political science
• Enviromental Studies
• Mass Media Communication
• Teaching Aptitude
• Verbal Ability & Reading Comprehension
• Logical Reasoning & Data Interpretation
• CAT Mock Test
• CAT Important Question
• CAT Vocabulary
• CAT English Grammar
• MBA General Knowledge
• CAT Mind Map
• CAT Study Planner
• CMAT Mock Test
• SRCC GBO Mock Test
• SRCC GBO PYQs
• XAT Mock Test
• SNAP Mock Test
• IIFT Mock Test
• MAT Mock Test
• CUET PG Mock Test
• CUET PG PYQs
• MAH CET Mock Test
• MAH CET PYQs
• NAVODAYA VIDYALAYA
• SAINIK SCHOOL (AISSEE)
• Mechanical Engineering
• Electrical Engineering
• Electronics & Communication Engineering
• Civil Engineering
• Computer Science Engineering
• CBSE Board News
• Scholarship Olympiad
• School Admissions
• Entrance Exams
• All Board Updates
• Miscellaneous
• State Wise Books
• Engineering Exam

SHARING IS CARING If our Website helped you a little, then kindly spread our voice using Social Networks. Spread our word to your readers, friends, teachers, students & all those close ones who deserve to know what you know now.

CBSE Class 12th - BIOLOGY : Chapterwise Case Study Question & Solution

CBSE will ask two Case Study Questions in the CBSE class 12 Biology questions paper. Question numbers 15 and 16 are case-based questions where 5 MCQs will be asked based on a paragraph. Each theme will have five questions and students will have a choice to attempt any four of them.

• NCERT Solutions for Class 12 Maths
• NCERT Solutions for Class 10 Maths
• CBSE Syllabus 2023-24
• Social Media Channels
• Login Customize Your Notification Preferences
• Can You Start Preparing for JEE in Class 12? Here's What You Need to Know 12 August, 2024, 6:26 pm
• CBSE Class 12 Compartment Results 2024 Released, Pass Percentage at 29.78% - Direct Link Here 2 August, 2024, 5:40 pm
• CBSE 12th Exam 2024-25 : Mathematics (Volume-2) Official Competency Focused Practice Questions released by CBSE 1 August, 2024, 5:46 pm
• CBSE 12th Exam 2024-25 : English (Volume-2) Official Competency Focused Practice Questions released by CBSE 1 August, 2024, 5:22 pm
• Education Budget 2024 : Major Education, Jobs, Women's Schemes and Upskilling Budget Highlights 24 July, 2024, 1:50 pm
• CBSE Class 12 Second Board Exam Set for June; Under Government Consideration 17 July, 2024, 11:21 am
• NIOS Class 12 Result 2024 Declared at results.nios.ac.in: Check Passing Marks and Details 22 June, 2024, 11:02 am
• Unlock Success After Class 12: Learn These 10 Essential Skills 15 June, 2024, 5:54 pm
• CBSE 12th 2024-25 : Physics Official Competency Focused Practice Questions released by CBSE 28 May, 2024, 4:12 pm

• Second click on the toggle icon

Provide prime members with unlimited access to all study materials in PDF format.

Allow prime members to attempt MCQ tests multiple times to enhance their learning and understanding.

Provide prime users with access to exclusive PDF study materials that are not available to regular users.

Pardon Our Interruption

As you were browsing something about your browser made us think you were a bot. There are a few reasons this might happen:

• You've disabled JavaScript in your web browser.
• You're a power user moving through this website with super-human speed.
• You've disabled cookies in your web browser.
• A third-party browser plugin, such as Ghostery or NoScript, is preventing JavaScript from running. Additional information is available in this support article .

To regain access, please make sure that cookies and JavaScript are enabled before reloading the page.

Lurie Children's and University of Utah Health receive $12 million for study on antibiotic use in pediatric pneumonia

• Download PDF Copy

Ann & Robert H. Lurie Children's Hospital of Chicago, in partnership with University of Utah Health, has been approved for $12 million in research funding by the Patient-Centered Outcomes Research Institute (PCORI) for a study that will compare two ways to use antibiotics in young children with mild pneumonia, one of the leading reasons children seek acute care, who are well enough to be cared for at home.

The first approach is to prescribe and give antibiotics immediately, which is the current standard of care. The second way is to prescribe an antibiotic but not give it unless the child's symptoms worsen or do not improve within three days, an approach that is known as a Safety-Net Antibiotic Prescription (SNAP). The study aims to determine whether SNAP, compared to immediate prescribing, results in decreased antibiotic use and similar clinical improvement in children with mild pneumonia.

Most pneumonias in young children are caused by a virus, which the body fights off without antibiotics. Despite this, most children with pneumonia are currently treated with antibiotics. It is important to avoid exposing children to unnecessary antibiotics for many reasons, including their side effects, such as rashes that can mimic allergies or an upset stomach. We also want to avoid the development of antibiotic-resistant bacteria, a global health threat. A SNAP treatment strategy is currently recommended for ear infections in children and has safely decreased antibiotic use for this condition. This strategy has not been evaluated in pneumonia. We hope our study shows a similar impact and identifies factors that influence implementation of a SNAP strategy." Todd Florin, MD, MSCE, Co-Principal Investigator,  Associate Division Head for Academic Affairs and Research in the Division of Emergency Medicine at Lurie Children's and Associate Professor of Pediatrics at Northwestern University Feinberg School of Medicine

The research team is working with 12 pediatric primary care offices and three urgent care centers that are part of the Pediatric Research Consortium at The Children's Hospital of Philadelphia, and four pediatric emergency departments across the country, including Lurie Children's and Utah's Intermountain Primary Children's Hospital, to enroll 1,823 children between 1 and 6 years of age who have been diagnosed with mild pneumonia. The team will assign children randomly to a group that receives immediate antibiotic prescribing or to a group that uses the SNAP approach.

The research team will follow up with the parent/guardian three times over the 14 days after the child's appointment to collect information about symptom improvement, antibiotic use, return to healthcare, child quality of life, parent satisfaction, and antibiotic side effects. The research team will also study how SNAP is implemented by talking to parents/guardians and pediatricians about factors that might make it easier or harder to use this approach.

Related Stories

• Over half of pneumonia patients face diagnostic uncertainty, study finds
• Alarming rise in sugary drink consumption among youth
• Alcohol use disorders in parents linked to accelerated aging in children

"The decision to compare immediate antibiotic prescribing and the SNAP approach was informed by our research on how parents and pediatricians feel about navigating the care of children with pneumonia in real-world settings," said Co-Principal Investigator Julia E. Szymczak, PhD, Associate Professor of Epidemiology and Co-Director of the Utah Quality Advancement Laboratory in the Department of Internal Medicine at the Spencer Fox Eccles School of Medicine at U of U Health. "It is important for researchers to generate evidence that patients and clinicians need to guide difficult healthcare decisions, such as when to use an antibiotic. Nobody wants to give unnecessary medicine, but it is scary to care for a child with pneumonia and it's often unclear whether an antibiotic will help. SNAP empowers parents to give their child a chance to fight off the infection on their own while also having fast access to antibiotics if it becomes clear they are needed."

The study was selected through PCORI's highly competitive review process in which patients, caregivers and other stakeholders join scientists to evaluate proposals. The award has been approved pending completion of PCORI's business and programmatic review and issuance of a formal award contract.

Ann & Robert H. Lurie Children's Hospital of Chicago

Posted in: Child Health News | Medical Research News

Tags: Antibiotic , Bacteria , Child Health , Children , Dentistry , Ear , Education , Emergency Medicine , Epidemiology , Global Health , Health Care , Healthcare , Hospital , Laboratory , Medicine , Nursing , Pediatrics , Pharmacy , Pneumonia , Primary Care , Research , Stomach , Virus

Suggested Reading

Cancel reply to comment

• Trending Stories
• Latest Interviews
• Top Health Articles

Addressing Important Cardiac Biology Questions with Shotgun Top-Down Proteomics

In this interview conducted at Pittcon 2024, we spoke to Professor John Yates about capturing cardiomyocyte cell-to-cell heterogeneity via shotgun top-down proteomics.

A Discussion with Hologic’s Tim Simpson on the Future of Cervical Cancer Screening

Tim Simpson

Hologic’s Tim Simpson Discusses the Future of Cervical Cancer Screening.

From Waste to Taste: The Transformative Power of Fermented Foods

Maria Marco

In this interview conducted at Pittcon 2024 in San Diego, Maria Marco discusses her research on the health benefits, safety, and waste reduction potential of fermented foods, and the microbial processes involved in their production.

Latest News

Newsletters you may be interested in

Your AI Powered Scientific Assistant

Hi, I'm Azthena, you can trust me to find commercial scientific answers from News-Medical.net.

A few things you need to know before we start. Please read and accept to continue.

• Use of “Azthena” is subject to the terms and conditions of use as set out by OpenAI .
• Content provided on any AZoNetwork sites are subject to the site Terms & Conditions and Privacy Policy .
• Large Language Models can make mistakes. Consider checking important information.

Great. Ask your question.

Azthena may occasionally provide inaccurate responses. Read the full terms .

While we only use edited and approved content for Azthena answers, it may on occasions provide incorrect responses. Please confirm any data provided with the related suppliers or authors. We do not provide medical advice, if you search for medical information you must always consult a medical professional before acting on any information provided.

Your questions, but not your email details will be shared with OpenAI and retained for 30 days in accordance with their privacy principles.

Please do not ask questions that use sensitive or confidential information.

Read the full Terms & Conditions .

Provide Feedback

Class 12 Biology Case Study Questions Chapter 7 Evolution

• Post author: studyrate
• Post published:
• Post category: Class 12 / 12 board
• Post comments: 0 Comments

In Class 12 Boards there will be Case studies and Passage Based Questions will be asked, So practice these types of questions. Study Rate is always there to help you. Free PDF Downloads of CBSE Class 12 Biology Chapter 7 Evolution Case Study and Passage-Based Questions with Answers were Prepared Based on the Latest Exam Pattern. Students can solve Class 12 Biology Case Study Questions Evolution  to know their preparation level.

Join our Telegram Channel, there you will get various e-books for CBSE 2024 Boards exams for Class 9th, 10th, 11th, and 12th.

In CBSE Class 12 Biology Paper, There will be a few questions based on case studies and passage-based as well. In that, a paragraph will be given, and then the MCQ questions based on it will be asked.

Evolution Case Study Questions With Answers

Here, we have provided case-based/passage-based questions for Class 12 Biology  Chapter 7 Evolution

Case Study/Passage-Based Questions

Case Study 1: When the reptiles came down, mammals took over the earth. There’ were mammals in South America, which resembled some of the modern day mammals. But due to continental drift, they disappeared whereas the pouched mammals of Australia flourished and evolved into the various forms of pouched mammals that we see today.

What event led to the rise of mammals on Earth? A) The arrival of birds B) The disappearance of reptiles C) Continental drift D) The evolution of pouched mammals

What unique type of mammals flourished and evolved in Australia? A) Rodents B) Primates C) Pouched mammals D) Hoofed mammals

What is the primary reason cited for the disappearance of certain mammals in South America? A) Predation by reptiles B) Continental drift C) Climate change D) Overpopulation

Why did pouched mammals specifically thrive in Australia, according to the passage? A) Lack of competition with other mammals B) Favorable climate conditions C) Protection from continental drift D) The passage does not specify

Which of the following is a well-known example of a pouched mammal? A) Elephant B) Kangaroo C) Whale D) Tiger

Continental drift refers to: A) The migration of animals between continents B) The slow movement of Earth’s continents over geological time C) The rapid sinking of continents into the ocean D) The growth of continents due to volcanic activity

Which era in Earth’s history is commonly associated with the dominance of reptiles? A) Paleozoic Era B) Mesozoic Era C) Cenozoic Era D) Proterozoic Era

What is one of the effects of continental drift on the distribution and evolution of species? A) It prevents species from migrating between continents B) It causes instant changes in climate C) It encourages hybridization between different species D) It leads to the simultaneous evolution of identical species on different continents

Case Study 2: According to the Hardy-Weinberg principle, the allele frequencies in a population are stable and remain constant through generations. When the frequency differs from the expected values, the difference indicates the extent (direction) of evolutionary change. Disturbance in the genetic equilibrium or Hardy-Weinberg equilibrium in a population can be interpreted as resulting in evolution.

What does the Hardy-Weinberg principle describe? A) The process of natural selection B) The stability of allele frequencies in a population C) The mechanism of genetic mutations D) The rate of evolutionary change over time

If a population is in Hardy-Weinberg equilibrium, what can be said about the allele frequencies? A) They change rapidly from generation to generation B) They remain constant from generation to generation C) They oscillate periodically D) They follow a predictable pattern of change

What does a deviation from Hardy-Weinberg equilibrium suggest? A) A population that is not evolving B) A population that is evolving C) A population that is experiencing genetic drift D) Both B and C

Which of the following factors could disturb Hardy-Weinberg equilibrium? A) Random mating B) Large population size C) Genetic mutation D) Absence of migration

If the allele frequencies within a population remain constant over time, what can be concluded about the population? A) It is undergoing rapid evolution B) It is not undergoing evolution C) It is experiencing a high rate of mutation D) It is subject to strong selection pressures

Hope the information shed above regarding Case Study and Passage Based Questions for Class 12 Biology Chapter 7 Evolution with Answers Pdf free download has been useful to an extent. If you have any other queries about the CBSE Class 12 Biology Evolution Case Study and Passage-Based Questions with Answers, feel free to comment below so that we can revert back to us at the earliest possible. By Team Study Rate

You Might Also Like

Class 12 physics case study questions chapter 9 ray optics and optical instruments, memories of childhood summary class 12 english pdf, class 12 chemistry case study questions chapter 9 coordination compounds, leave a reply cancel reply.

Save my name, email, and website in this browser for the next time I comment.

This site uses Akismet to reduce spam. Learn how your comment data is processed .

The Topper Combo Flashcards

• Contains the Latest NCERT in just 350 flashcards.
• Colourful and Interactive
• Summarised Important reactions according to the latest PYQs of NEET(UG) and JEE

No thanks, I’m not interested!

Gurukul of Excellence

Classes for Physics, Chemistry and Mathematics by IITians

Join our Telegram Channel for Free PDF Download

Case Study Questions for Class 12 Biology Chapter 13 Organisms and Populations

• Last modified on: 2 years ago
• Reading Time: 4 Minutes

Question 1:

Organism P has thick lips and tongue so that it can easily feed on the commonly available spiny plants. Organism Q has thick layer of insulating fat under the skin. It was strong hooves to walk steadily on steep surfaces and lives in burrows during winters. Organism R has bright colours and sticky pads on its fingers and toes. It lives on trees.

(i) Which of the following is correct habitat for organisms P regarding its adaptation? (a) Grassland biome (b) Desert biome (c) Tropical rainforest (d) Tropical deciduous forest

(ii) Which of the following is correct match regarding organism Q and its habitat? (a) Tundra – Polar bear (b) Tropical rain forest – Deer (c) Grassland – Bighorn sheep (d) Desert – Camel

(iii) Which of the following is incorrect regarding organisms R’s habitat? (a) The vegetation shows stratification (b) Epiphytic growth is rich (c) Standing crop is highest (d) Deep rooted shrubs are common due to abundant sunlight

(iv) The dominant plants in habitat where P lives could be (a) Opuntia (b) Nymphaea (c) Deodar (d) both (a) and (c).

(v) Organisms P, Q and R respectively most likely occur in

(a) F, B and A (b) C, A, E (c) A, F and C (d) B, D and A.

You may also like:

Case Study and Passage Based Questions for Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants

Last modified on:2 years agoReading Time:4MinutesIn CBSE Class 12 Biology Paper, Students will have to answer some questions based on Assertion and Reason. There will be a few questions based on case studies and passage based as well. In that, a paragraph will be given, and then the MCQ questions based on it will be asked.…

Case Study and Passage Based Questions for Class 12 Biology Chapter 3 Human Reproduction

Last modified on:2 years agoReading Time:4MinutesIn CBSE Class 12 Biology Paper, Students will have to answer some questions based on Assertion and Reason. There will be a few questions based on case studies and passage based as well. In that, a paragraph will be given, and then the MCQ questions based on it will be asked. Here,…

Case Study Questions for Class 12 Biology Chapter 8 Human Health and Diseases

Last modified on:2 years agoReading Time:6MinutesCase Study Questions for Class 12 Biology Chapter 8 Human Health and Diseases Question 1: In a study to test a new vaccine against a viral disease, mouse model testing is done. In this process, mice are vaccinated and their blood samples were tested. Mice developed mild disease symptom. After few…

Case Study Questions for Class 12 Biology Chapter 10 Microbes in Human Welfare

Last modified on:2 years agoReading Time:3MinutesCase Study Questions for Class 12 Biology Chapter 10 Microbes in Human Welfare Question 1: Villagers in a place near Chambur started planning to make power supply for agricultural purposes from cow dung. They have started a biogas plant for the purpose. Study the flow chart for biogas production given below…

Case Study Questions for Class 12 Biology Chapter 11 Biotechnology – Principles and Techniques

Last modified on:2 years agoReading Time:4MinutesCase Study Questions for Class 12 Biology Chapter 11 Biotechnology – Principles and Techniques Question 1: The DNA, which is transferred from one organism into another by joining it with the vehicle DNA is called passenger or foreign DNA. Generally three types of passenger DNAs are used. These are complementary DNA…

Case Study Questions for Class 12 Biology Chapter 12 Biotechnology and Its Applications

Last modified on:2 years agoReading Time:5MinutesCase Study Questions for Class 12 Biology Chapter 12 Biotechnology and Its Applications Question 1: Transgenic cows have extra gene or genes inserted into their DNA. Firstly the genes for the desired product is identified and sequenced. Then a gene construct containing this desired gene is introduced into female cow cells.…

Last modified on:2 years agoReading Time:4MinutesCase Study Questions for Class 12 Biology Chapter 13 Organisms and Populations Question 1: Organism P has thick lips and tongue so that it can easily feed on the commonly available spiny plants. Organism Q has thick layer of insulating fat under the skin. It was strong hooves to walk steadily…

Case Study Questions for Class 12 Biology Chapter 15 Biodiversity and Conservation

Last modified on:2 years agoReading Time:4MinutesCase Study Questions for Class 12 Biology Chapter 15 Biodiversity and Conservation Question 1: Within a region, species richness increases with increasing explored area, but only upto a limit. The given graph explains this relationship. (i) What does the given figure show?(a) Rivet-popper hypothesis(b) Species-area relationship(c) Proportionate number of species of…

Case Study and Passage Based Questions for Class 12 Biology Chapter 1 Reproduction in Organisms

Last modified on:2 years agoReading Time:3MinutesCase Study/Passage Based Questions: Question 1: Given below is the diagram of a ginger rhizome. Answer the questions given below based onthe diagram. (i) Why do vegetative propagules in sugarcane and ginger appear from the nodes?(ii) Name the vegetative propagules in (a) Potato, and (b) Pistia.(iii) How does potato multiply? Answer…

Case Study and Passage Based Questions for Class 12 Biology Chapter 4 Reproductive Health

Last modified on:2 years agoReading Time:2MinutesCase Study and Passage Based Questions for Class 12 Biology Chapter 4 Reproductive Health Case Study/Passage Based Questions: Question 1: Study the diagram of the female reproductive system given below. Answer the questionsbased on the diagram. (i) What does the diagram depict?(ii) At what stage zygote can be introduced in the…

Download CBSE Books

Exam Special Series:

• Sample Question Paper for CBSE Class 10 Science (for 2024)
• Sample Question Paper for CBSE Class 10 Maths (for 2024)
• CBSE Most Repeated Questions for Class 10 Science Board Exams
• CBSE Important Diagram Based Questions Class 10 Physics Board Exams
• CBSE Important Numericals Class 10 Physics Board Exams
• CBSE Practical Based Questions for Class 10 Science Board Exams
• CBSE Important “Differentiate Between” Based Questions Class 10 Social Science
• Sample Question Papers for CBSE Class 12 Physics (for 2024)
• Sample Question Papers for CBSE Class 12 Chemistry (for 2024)
• Sample Question Papers for CBSE Class 12 Maths (for 2024)
• Sample Question Papers for CBSE Class 12 Biology (for 2024)
• CBSE Important Diagrams & Graphs Asked in Board Exams Class 12 Physics
• Master Organic Conversions CBSE Class 12 Chemistry Board Exams
• CBSE Important Numericals Class 12 Physics Board Exams
• CBSE Important Definitions Class 12 Physics Board Exams
• CBSE Important Laws & Principles Class 12 Physics Board Exams
• 10 Years CBSE Class 12 Chemistry Previous Year-Wise Solved Papers (2023-2024)
• 10 Years CBSE Class 12 Physics Previous Year-Wise Solved Papers (2023-2024)
• 10 Years CBSE Class 12 Maths Previous Year-Wise Solved Papers (2023-2024)
• 10 Years CBSE Class 12 Biology Previous Year-Wise Solved Papers (2023-2024)
• ICSE Important Numericals Class 10 Physics BOARD Exams (215 Numericals)
• ICSE Important Figure Based Questions Class 10 Physics BOARD Exams (230 Questions)
• ICSE Mole Concept and Stoichiometry Numericals Class 10 Chemistry (65 Numericals)
• ICSE Reasoning Based Questions Class 10 Chemistry BOARD Exams (150 Qs)
• ICSE Important Functions and Locations Based Questions Class 10 Biology
• ICSE Reasoning Based Questions Class 10 Biology BOARD Exams (100 Qs)

✨ Join our Online NEET Test Series for 499/- Only for 1 Year

Leave a Reply Cancel reply

Editable Study Materials for Your Institute - CBSE, ICSE, State Boards (Maharashtra & Karnataka), JEE, NEET, FOUNDATION, OLYMPIADS, PPTs

Discover more from Gurukul of Excellence

Subscribe now to keep reading and get access to the full archive.

Type your email…

Continue reading

Case Study Question for Class 12 Biology Ch. 1, 2, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16

Understudies can discover the chapter astute vital questions for course 12th Biology within the table underneath. These imperative questions incorporate questions that are regularly inquired in a long time. Moreover, arrangements are to give for these questions, with extraordinary accentuation on ease-of-study. Tap on the joins underneath to begin investigating.

Case Study Question for Class 12 Biology Ch 1 to 16

Case study 01:.

Ans: The two different DNA molecules will have compatible ends to recombine.

Ans: Restriction enzyme cuts the DNA of the vector and then ligates the gene of interest into the DNA of the vector.

If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.

Ans: BamH1 site will affect tetracycline antibiotic resistance gene, hence the recombinant plasmids will lose tetracycline resistance due to inactivation of the resistance gene

Case Study 02:

Because the use of pesticides is highly reduced for Bt crop // Decrease of pesticide used is also more significant for Bt crop.

(b)  Cotton Bollworms were introduced in another experimental study on the above farm lands wherein no pesticide was used. Explain what effect would a Bt and Non Bt crop have on the pest.

Case Based Questions Class 12 Biology Chapterwise

Leave a Reply Cancel reply

We have a strong team of experienced teachers who are here to solve all your exam preparation doubts, maharashtra board class 4 english chapter 8 a great leader solution, maharashtra board class 4 english chapter 5 six honest serving-men solution, maharashtra board class 4 english chapter 6 it’s only a matter of practice solution, jharkhand board solutions class 5 english chapter 9.

A bone-derived protein primes rapid visual escape via GPR37 receptor in a subpopulation of VTA GABAergic neurons

• Find this author on Google Scholar
• Find this author on PubMed
• Search for this author on this site
• For correspondence: [email protected]
• Info/History
• Supplementary material
• Preview PDF

Rapid escape against visual threats is critical for survival. Whether it requires a permissive mechanism is unknown. Here, we show that osteocalcin (OCN), a protein produced by bone and persisted in the brain, primes rapid visual escape response by increasing excitability of VTA GABAergic neuron subpopulation via OCN-GPR37-cAMP-THIK-1 (K2P13.1) pathway. Knock-out of OCN or its receptor GPR37, and conditional knock-out of GPR37 in VTA GABAergic or glutamatergic neurons caused delayed escape. Reconstituting OCN-GPR37 signaling specifically in VTA was sufficient to restore normal response. Single-cell transcriptomics combined with electrophysiology showed that OCN decreases potassium currents in a subpopulation of VTA GABAergic neurons via GPR37-induced cAMP reduction and subsequent THIK-1 suppression. This elevation of excitability in VTA neuron subpopulation can be recapitulated by HM4Di, an inhibitory chemogenetic GPCR commonly used to suppress neuronal activity. Our study demonstrated that visual behavior requires a bone-derived protein that tunes electrophysiology of central nervous system neurons.

Competing Interest Statement

The authors have declared no competing interest.

https://www.bonebrainbcbdi.com

View the discussion thread.

Supplementary Material

Thank you for your interest in spreading the word about bioRxiv.

NOTE: Your email address is requested solely to identify you as the sender of this article.

Citation Manager Formats

• EndNote (tagged)
• EndNote 8 (xml)
• RefWorks Tagged
• Ref Manager
• Tweet Widget
• Facebook Like
• Google Plus One

Subject Area

• Neuroscience
• Animal Behavior and Cognition (5518)
• Biochemistry (12552)
• Bioengineering (9417)
• Bioinformatics (30790)
• Biophysics (15833)
• Cancer Biology (12904)
• Cell Biology (18496)
• Clinical Trials (138)
• Developmental Biology (9992)
• Ecology (14947)
• Epidemiology (2067)
• Evolutionary Biology (19142)
• Genetics (12727)
• Genomics (17524)
• Immunology (12664)
• Microbiology (29683)
• Molecular Biology (12359)
• Neuroscience (64654)
• Paleontology (479)
• Pathology (2000)
• Pharmacology and Toxicology (3449)
• Physiology (5322)
• Plant Biology (11070)
• Scientific Communication and Education (1728)
• Synthetic Biology (3061)
• Systems Biology (7681)
• Zoology (1728)