peer pressure conformity experiment

The Asch Line Study (+3 Conformity Experiments)

Sheep. Complicit. Doormat. There are a lot of negative connotations associated with conformity, especially in the United States. Individualist societies push back on "going along with what everyone is doing." And yet, we conform more than we think. According to studies like the Asch Line Study, humans have a natural tendency to conform.

The Asch Line Study is one of the most well-known experiments in modern psychology, but it's not without its faults. Keep reading to learn about how the Asch Line Study worked, its criticisms, and similar experiments!

How Did the Asch Line Study Work?

In his famous “Line Experiment”, Asch showed his subjects a picture of a vertical line followed by three lines of different lengths, one of which was obviously the same length as the first one. He then asked subjects to identify which line was the same length as the first line.

Solomon Asch used 123 male college students as his subjects, and told them that his experiment was simply a ‘vision test’. For his control group, Asch just had his subjects go through his 18 questions on their own.

However, for his experimental group, he had his subjects answer each of the same 18 questions in a group of around a dozen people, where the first 11 people intentionally said obviously incorrect answers one after another, with the final respondee being the actual subject of the experiment.

Who was Solomon Asch?

Solomon E. Asch was a pioneer in social psychology. He was born in Poland in 1907 and moved to the United States in 1920. Asch received his Ph.D. from Columbia University in 1932 and went on to perform some famous psychological experiments about conformity in the 1950s.

One of these studies is known as the “Asch Line Experiment”, where he found evidence supporting the idea that humans will conform to and accept the ideas of others around them, even if those ideas are obviously false. This study is one of the most influential studies in social psychology .

Findings of Asch's Conformity Study

Asch found that his subjects indeed were more likely to give a false response after the other members of their group (the actors) gave false responses. As shown in this ‘Table 1’ from his experiment, during 18 trials, the ‘Majority Error’ column shows no error when the group response was the correct response, such as in Trial #1.

However, when the entire group intentionally gave a false answer (these situations are designated with an * under the “Group Response” column), the ‘Majority Error’ did exist and was slanted toward the opinion of the group.

For example, if the group answered with a line that was too long, such as in Trial #3, the ‘Majority Error’ column shows that the subjects generally estimated the line to be longer than it really was (denoted with a ‘+’), and vice-versa for when the group answered with a line that was too short, such as in Trial #4.

As for his control group, Asch found that people generally said the correct answer when they did not have a group of actors saying answers before them.

Interviewing the Participants

After the experiment, Asch revealed the true experiment to his subjects and interviewed them. Some subjects had become very agitated during the experiment, wondering why they kept disagreeing with the group. When the group pressed one particular subject on why he thought that he was correct and the entire group was wrong, he replied defiantly, exclaiming: “You're probably right, but you may be wrong!”

Other subjects admitted during the interview that they changed their answers after hearing others in their group reply differently. One was recorded saying, “If I’d been the first I probably would have responded differently.” Another subject admitted, “...at times I had the feeling: 'to heck with it, I'll go along with the rest.' "

Conclusions from the Asch Line Study

Asch found that his subjects often changed their answers when they heard the rest of the group unanimously giving a different response.

After the interviews, Asch concluded in his study that his subjects conformed to the opinions of the group for three different reasons:

Distortion of perception due to the stress of group pressure: This group of subjects always agreed with the group and said during the interview that they wholeheartedly believed that their obviously incorrect answers were correct. Asch concluded that the stress of group pressure had distorted their perception.

Distortion of judgment: This was the most common outcome, where subjects assumed that their individual answers were incorrect after seeing the rest of the group answer differently, so they changed their answer to align with the group.

Distortion of action: These subjects never doubted that they were correct and the group was wrong, but out of fear of being perceived as different, they suppressed their opinions and intentionally lied when it was their turn to give an answer.

Asch Line Study vs. Milgram Experiment

Both the Asch Line Study and the Milgram Experiment look at conformity, obedience, and the negative effects of going along with the majority opinion. Those negative effects are slightly awkward, like in the Asch Line Study, or dangerous, like in the Milgram Experiment. Both experiments were conducted in the Post-WWII world as a response to the conformity that was required for Nazi Germany to gain power. The premise of Asch's study was not nearly as dramatic. Milgram's was.

To test conformity, Milgram and his researchers instructed participants to press a button. Participants believed that the buttons would shock another "participant" in a chair, who was really an actor. (No one was shocked.) The study continued as long as participants continued to shock the participant at increasingly dangerous levels. The participants knew that they could cause serious harm to the person in the chair. Yet, many obeyed.

Further Experiments and Variations

Solomon Asch didn't just conduct one experiment and move on. He replicated his experiment with new factors, including:

Changing the size of the actor group
Switching to a non-unanimous actor group
Having a unanimous actor group, except for one actor who sticks to the correct response no matter what the group or subject says
Instructing the one actor who gives the correct response come in late
Having one actor decide to change their answer from the group’s answer to the subject’s answer

There are also many reproductions and replications of this study online. Not all of them come to the same conclusions! Read through the following texts to get a sense of how other psychologists approached this subject:

Mori K, Arai M. No need to fake it: reproduction of the Asch experiment without confederates. Int J Psychol. 2010 Oct 1;45(5):390-7. doi: 10.1080/00207591003774485. PMID: 22044061.

Why Is The Asch Line Study Ethnocentric? And Other Criticisms

One big issue with the Asch line study is that the subjects were all white male college students between the ages of 17 and 25, with a mean age of 20. Since the experiment only shows results for this small and specific group of people, it alone cannot be applied to other groups such as women or older men.

Experimenter Bias in the Asch Line Study

Only choosing subjects from one demographic is a form of Experimenter Bias . Of course, researchers can use one demographic if they are specifically studying that demographic. But Asch was not just looking at young, white men. If he had expanded his research to include more participants, he may have produced different answers.

We assume Asch did not go about his study with the intention of being biased. That's the tricky thing about biases. They sneak up on us! Even the way that we share information about psychology research is the result of bias. Reporter bias is the tendency to highlight certain studies due to their results. The Asch Line Study produced fascinating results. Therefore, psychology professors, reporters, and students find it fascinating and continue to share this concept. They don't always share the full story, though.

Did you know that 95% of the participants actually defied the majority at least once during the experiment? Most textbooks don't report that. Nor did they report that the interviewees knew that they were right all along! Leaving out this key information is not Asch's fault. But it should give you, a psychology student, some pause. One thing that we should take away from this study is that we have a natural tendency to conform. This tendency also takes place when we draw conclusions from famous studies! Be critical as you learn about these famous studies and look to the source if possible.

Further Criticisms of the Asch Line Study

Does the Asch Line Study stand the test of time? Not exactly. If we look at what was happening in 1950s society, we can see why Asch got his results. Young white men in the early 1950s may have responded differently to this experiment than young white men would today. In the United States, which is where this experiment was performed, the mid-1950s was a historic turning point in terms of rejecting conformity. Youth were pushing toward a more free-thinking society. This experiment was performed right around the time that the movement was just starting to blossom, so the subjects had not grown up in the middle of this new anti-conformist movement. Had Asch performed this experiment a decade later with youth who more highly valued free-thinking, he may have come across very different results.

Another thing to note is that, at least in the United States, education has evolved with this movement of encouraging free-thinking. Teachers today tell students to question everything, and many schools reject ideas of conformity. This could once again mean that, if done again today, Asch would have found very different results with this experiment.

Another problem with this experiment is that, since subjects were not told it was a psychological experiment until after it was over, subjects may have gone through emotional and psychological pain during what they thought was just a simple ‘vision test’.

Finally, it’s good to remember that the ‘Asch Line Experiment’ is just that: an experiment where people looked at lines. This can be hard to apply to other situations because humans in group settings are rarely faced with questions that have one such obvious and clear answer, as was the case in this experiment.

Solomon Asch (Psychologist Biography)
40+ Famous Psychologists (Images + Biographies)
Stanley Milgram (Psychologist Biography)
Experimenter Bias (Definition + Examples)
The Monster Study (Summary, Results, and Ethical Issues)

Reference this article:

About The Author

PracticalPie.com is a participant in the Amazon Associates Program. As an Amazon Associate we earn from qualifying purchases.

Youtube Facebook Instagram X/Twitter

Psychology Resources

Developmental

Personality

Relationships

Psychologists

Serial Killers

Psychology Tests

Personality Quiz

Memory Test

Depression test

Type A/B Personality Test

Asch Conformity Experiments: Line Study

Categories Social Psychology

Will people conform to the group’s opinions, even if they disagree? That was the question behind one of the most famous experiments in psychology history. The Asch conformity experiments were a series of studies by social psychologist Solomon Asch during the 1950s. In the studies, Asch sought to learn more about how social pressure could lead to conformity .

In the studies, people were asked to choose a line that matched the length of another line. When the others in the group chose the incorrect line, participants would often conform to the rest of the group, even though they were clearly wrong.

The experiments are classic studies in social psychology, offering important insights into when and why people conform to group norms and pressures.

Line task from the Asch conformity experiments

Table of Contents

The Asch Experiments

In the main version of the experiment, Asch told the participants that they were taking part in a vision test. Each participant was then placed in a group of people who were actually confederates in the study. In other words, they were actors who were involved in the experiment.

The group was shown a line on a card and then another card with several lines of varying lengths. They were asked to pick the line that matched the first line.

It was a simple task. When asked on their own, almost all participants were able to easily perform the task correctly. When they were in the group, and the confederates gave the wrong answers, the participants were often go along with the group.

Results of the Asch Conformity Experiments

The results of the Asch conformity experiments were startling. They revealed that a staggering 75% of the participants conformed to the group at least once. Even more surprising, about 25% never conformed, while 5% conformed every single time.

For the control group, where people faced no social pressure, incorrect responses were given less than 1% of the time.

Explanations for the Results

What explains the high rates of conformity in Asch’s experiments? There are several important psychological factors at work. The reasons people went along with the group even when they knew the others were wrong come down to several reasons:

Normative Social Influence

People have a desire for social acceptance. They want to fit in with the group and prefer not to stand out. By agreeing with the rest of the group, they increase the likelihood of being liked and accepted by others.

The fear of embarrassment can also play a role. Being the only one to voice a different answer comes with the risk of appearing foolish or being ridiculed. Even if people knew they were right, fear of social disapproval caused them to conform.

Informational Social Influence

When making decisions under uncertainty, people often look to other people as a source of information. If other people say one thing is correct, people often assume that others know something they don’t, which is why they conform.

Self-doubt in these situations can also play a role. Once others started choosing the wrong answer, the participants may have started to question their response and wondered if they had overlooked something.

Other Factors That Can Influence Conformity

There are also a number of other factors that can affect the likelihood that people with conform like they did Asch conformity experiments.

These include:

Group size : Conformity usually increases with group size, at least up to a certain point. When 3 to 5 people are present, there is a lot of pressure to conform. When the number of people exceeds that, conformity typically starts to decline.
Status : People are more likely to conform if the others in the group are seen as having a higher status, more authority, or greater expertise.
Privacy of responses : People are more inclined to conform if their responses are public. When responses are private, conformity rates drop.
Uncertainty and difficulty : If the task is ambiguous or difficult, people are less likely to trust their own judgment. They will often look to others for information and assurance, which increases conformity.
Group unity : Conformity is higher in very cohesive groups. The stronger the bonds between group members, the more likely people are to conform.

In a 2023 replication of Asch’s conformity experiment, researchers found an error rate of 33%, similar to the one in Asch’s original study. They found that offering monetary incentives helped reduce errors but didn’t eliminate the effects of social influence. The study also found that social influence impacted political opinions, leading to a conformity rate of 38% (Franzen & Mader, 2023).

The study also examined how Big Five personality factors might be linked to conformity. While openness was associated with susceptibility to group pressure, other personality traits were not significantly connected.

One 2018 experiment found that the social delivery of information caused 33% of participants to change their political opinions (Mallinson & Hatemi, 2018).

Critiques of the Asch Conformity Experiments

While influential, the Asch experiments were not without criticism. Some of the main criticisms hinge on the following:

The impact of demand characteristics : Some critics suggest that some participants may have suspected the study’s real intentions and behaved to meet the experimenter’s expectations.
Lack of relevance in the real world : Critics also suggest that the experimental setup needed to be more contrived and accurately reflect real-world situations where conformity might occur.
Cultural factors : The time and place of the experiments (the United States and during the 1950s) may also have contributed to the high conformity rates. During that time, conformity to American norms and values was highly valued. Such characteristics may not be universal to other places and periods.
Simplified approach: While Asch’s experiments demonstrate one aspect of conformity (normative social influence), they don’t address the many other factors that can contribute to this behavior in real-world settings.

Impact and Contributions of the Asch Conformity Experiments

Asch’s conformity experiments had a major impact on the field of psychology. They helped inspire further research on conformity, compliance, and obedience.

The studies demonstrated that conformity is not just about fear of punishment ; it often comes from a deep psychological need for acceptance and group harmony.

These findings have influenced a wide range of fields, from understanding peer pressure and decision-making in groups to exploring the dynamics of social behavior in various cultural and political contexts. Asch’s experiments remain a cornerstone in social psychology , shaping how we think about the relationships between individual judgment and group influence.

Search form

Experiments
Anthropology
Self-Esteem
Social Anxiety

Psychology >

Asch Experiment

A series of studies conducted in the 1950's, a series of studies conducted in the 1950's.

The Asch Experiment, by Solomon Asch, was a famous experiment designed to test how peer pressure to conform would influence the judgment and individuality of a test subject.

This article is a part of the guide:

Social Psychology Experiments
Milgram Experiment
Bobo Doll Experiment
Stanford Prison Experiment
Milgram Experiment Ethics

Browse Full Outline

1 Social Psychology Experiments
2.1 Asch Figure
3 Bobo Doll Experiment
4 Good Samaritan Experiment
5 Stanford Prison Experiment
6.1 Milgram Experiment Ethics
7 Bystander Apathy
8 Sherif’s Robbers Cave
9 Social Judgment Experiment
10 Halo Effect
11 Thought-Rebound
12 Ross’ False Consensus Effect
13 Interpersonal Bargaining
14 Understanding and Belief
15 Hawthorne Effect
16 Self-Deception
17 Confirmation Bias
18 Overjustification Effect
19 Choice Blindness
20.1 Cognitive Dissonance
21.1 Social Group Prejudice
21.2 Intergroup Discrimination
21.3 Selective Group Perception

The experiment is related closely to the Stanford Prison and Milgram Experiments , in that it tries to show how perfectly normal human beings can be pressured into unusual behavior by authority figures, or by the consensus of opinion around them.

For the experiment, eight subjects were seated around a table, with the seating plan carefully constructed to prevent any suspicion.

Only one participant was actually a genuine subject for the experiment, the rest being confederates, carefully tutored to give certain pre-selected responses. Careful experimental construction placed a varying amount of peer pressure on the individual test subject.

The participants gave a variety of answers, at first correct, to avoid arousing suspicion in the subject, but then with some incorrect responses added.

This would allow Asch to determine how the answers of the subject would change with the added influence of peer pressure.

The Asch Experiment results were interesting and showed that peer pressure could have a measurable influence on the answers given.

The control group , those not exposed to peer pressure where everybody gave correct answers, threw up only one incorrect response out of 35; this could probably be explained by experimental error .

The results for the other groups were interesting; when surrounded by people giving an incorrect answer, over one third of the subjects also voiced an incorrect opinion.

At least 75% of the subjects gave the wrong answer to at least one question, although experimental error may have had some influence on this figure. There was no doubt, however, that peer pressure can cause conformity.

It was debated whether this is because people disbelieve the evidence of their own eyes or if it was just compliance, that people hide their opinions.

Follow ups to the Asch Experiment showed that the number of dissenting voices made a difference to the results, as did the forcefulness of the confederates.

One incorrect confederate made little difference to the answers, but the influence steadily increased if two or three people disagreed.

The figures did not change much after this point; more confederates made little difference. The number of people in the group also made a difference; the influence of dissenting voices leveled off for groups of more than six or seven people.

The experiments also showed that, even if only one other participant disagreed with the confederates, the subject was more likely to resist peer pressure; it appears to be more difficult to resist the majority if isolated.

The Asch Experiment showed that one voice can make a difference amongst many.

There have been a number of criticisms of Asch's experiments; the subjects were all young males, and they tend to be much more impressionable than older men. More mature people have had enough experience of life, and more mental strength; they are more likely to hold true to their convictions.

Another criticism, that the experiment lacks ecological credibility and does not relate to real-life situations, is one that can be leveled at many psychological experiments, including the Milgram Experiment and the Stanford Prison Experiment.

Other follow up experiments, where the subjects were allowed to write down responses anonymously, showed far fewer incorrect answers. The comfort of anonymity made sure that looking foolish became much less of a pressure.

Psychology 101
Flags and Countries
Capitals and Countries

Martyn Shuttleworth (Feb 23, 2008). Asch Experiment. Retrieved Aug 25, 2024 from Explorable.com: https://explorable.com/asch-experiment

You Are Allowed To Copy The Text

The text in this article is licensed under the Creative Commons-License Attribution 4.0 International (CC BY 4.0) .

This means you're free to copy, share and adapt any parts (or all) of the text in the article, as long as you give appropriate credit and provide a link/reference to this page.

That is it. You don't need our permission to copy the article; just include a link/reference back to this page. You can use it freely (with some kind of link), and we're also okay with people reprinting in publications like books, blogs, newsletters, course-material, papers, wikipedia and presentations (with clear attribution).

Want to stay up to date? Follow us!

Save this course for later.

Don't have time for it all now? No problem, save it as a course and come back to it later.

Footer bottom

Subscribe to our RSS Feed
Like us on Facebook
Follow us on Twitter

The Asch Conformity Experiments

What Solomon Asch Demonstrated About Social Pressure

Recommended Reading
Key Concepts
Major Sociologists
News & Issues
Research, Samples, and Statistics
Archaeology

The Asch Conformity Experiments, conducted by psychologist Solomon Asch in the 1950s, demonstrated the power of conformity in groups and showed that even simple objective facts cannot withstand the distorting pressure of group influence.

The Experiment

In the experiments, groups of male university students were asked to participate in a perception test. In reality, all but one of the participants were "confederates" (collaborators with the experimenter who only pretended to be participants). The study was about how the remaining student would react to the behavior of the other "participants."

The participants of the experiment (the subject as well as the confederates) were seated in a classroom and were presented with a card with a simple vertical black line drawn on it. Then, they were given a second card with three lines of varying length labeled "A," "B," and "C." One line on the second card was the same length as that on the first, and the other two lines were obviously longer and shorter.

Participants were asked to state out loud in front of each other which line, A, B, or C, matched the length of the line on the first card. In each experimental case, the confederates answered first, and the real participant was seated so that he would answer last. In some cases, the confederates answered correctly, while in others, the answered incorrectly.

Asch's goal was to see if the real participant would be pressured to answer incorrectly in the instances when the Confederates did so, or whether their belief in their own perception and correctness would outweigh the social pressure provided by the responses of the other group members.

Asch found that one-third of real participants gave the same wrong answers as the Confederates at least half the time. Forty percent gave some wrong answers, and only one-fourth gave correct answers in defiance of the pressure to conform to the wrong answers provided by the group.

In interviews he conducted following the trials, Asch found that those that answered incorrectly, in conformance with the group, believed that the answers given by the Confederates were correct, some thought that they were suffering a lapse in perception for originally thinking an answer that differed from the group, while others admitted that they knew that they had the correct answer, but conformed to the incorrect answer because they didn't want to break from the majority.

The Asch experiments have been repeated many times over the years with students and non-students, old and young, and in groups of different sizes and different settings. The results are consistently the same with one-third to one-half of the participants making a judgment contrary to fact, yet in conformity with the group, demonstrating the strong power of social influences.

Connection to Sociology

The results of Asch's experiment resonate with what we know to be true about the nature of social forces and norms in our lives. The behavior and expectations of others shape how we think and act on a daily basis because what we observe among others teaches us what is normal , and expected of us. The results of the study also raise interesting questions and concerns about how knowledge is constructed and disseminated, and how we can address social problems that stem from conformity, among others.

Updated by Nicki Lisa Cole, Ph.D.

An Overview of the Book Democracy in America
The Social Transformation of American Medicine
McDonaldization: Definition and Overview of the Concept
Understanding Durkheim's Division of Labor
Émile Durkheim: "Suicide: A Study in Sociology"
Malcolm Gladwell's "The Tipping Point"
The Presentation of Self in Everyday Life
Definition of the Sociological Imagination and Overview of the Book
Stigma: Notes on the Management of Spoiled Identity
The Main Points of "The Communist Manifesto"
Overview of The History of Sexuality
A Book Overview: "The Protestant Ethic and The Spirit Of Capitalism"
Savage Inequalities: Children in America’s Schools
15 Major Sociological Studies and Publications
Learn About Various Sanctions in Forcing Compliance With Social Norms
Understanding Resocialization in Sociology

Is Gambling Evil?: Understanding Gambling Disorder and its Causes
We all need to (and can) get back on our feet after facing an Academic Failure
Study Reveals Potential Link Between Multiple Sclerosis and Reduced Alzheimer’s Risk
Calm Your Nerves: Dietary Changes for Reducing Anxiety
Non-Suicidal Self-Injury

Your cart is empty

The Asch Conformity Experiment and Its Implications

by Psychologs Magazine
June 13, 2024
4 minutes read

Social Psychology is a field of psychology that aims to study the behaviour of human beings in a social context. It examines how our behaviour, ideas, feelings, and emotions are affected by the presence of others in an environment. Group behaviour, peer pressure, interpersonal relations, prejudice, and conformity are some of the major concepts studied in this field. The information on these is derived from social experiments conducted by psychologists in the past. The Stanford Prison Experiment , the Bystander Experiment , and the Asch Conformity Test remain some of the important ones. These tests have been replicated several times over the many years, and hence remain valuable in the study of psychology.

The Asch Conformity Experiment

The Asch Conformity Experiment is a popular experiment that is used to study group behaviour and conformity. It was designed by the pioneering social psychologist Solomon Asch. In this test, he studied how individual cognition can be affected by external influence when in a group.

Experiment Design

For this experiment, Asch seated several students in a classroom, some of which were confederates or actors who already knew the experiment, while others were unaware of it. He then showed them a picture and asked them to match the target line to the line which they believed was equal to it.

Experiment Procedure

In the first few rounds, the actors were asked to respond first and were told to give the correct answer. This affected the opinion of the others, and the subjects began to give similar answers, despite whatever their personal opinion was. In the later rounds, the Confederates started to change their answer to the wrong option. Hence, even though the participants knew what the correct answer was, due to the first trials, they began to doubt their choice and shifted their opinion according to the majority.

Results and Analysis

Eighteen such trials were conducted with 123 subjects. When the experimenters analyzed the results, they concluded that:

23% of the students always gave the right answer,
72% conformed with the majority at least once,
5% of them were always with the majority group, giving the wrong answer.

This change in opinion was due to peer pressure. According to his analysis, Asch concluded that the opinion of a minimum of 3 students was needed to get the majority group to reconsider their opinions.

Implications of the Experiment

Groupthink and peer pressure.

The success of this experiment and its replicability over time have led to further exploration in the domain, leading to the ideas of groupthink and peer pressure. Several examples of this can be seen in our daily life as well.

Social Media Influence

With changing times and expanding technology, social media is now more accessible than ever before. This increased access and continuous exposure leads to youngsters succumbing to the changing trends owing to the need to identify with the majority and remain relevant in changing times. This sometimes also leads to unhealthy comparisons with others. It also kills the individuality and uniqueness of a person which was supposed to make them stand out from one another.

Education and Peer Pressure

Similarly, the expression of peer pressure can be largely seen in the domain of education, where students today feel the need to excel and prove themselves due to the growing competitiveness and comparison among them. When cohesive group behaviour is within a certain limit, it is beneficial for the students as it becomes a source of motivation for each other. Here, group conformity leads to increased self-esteem . But when this cohesiveness and comparison reach unhealthy levels, it begins to take a toll on mental health due to the dissonance between personal and external needs, eventually forcing students to take extreme steps in certain severe cases, by indulging in self-harm or even suicide.

Household Conformity and Obedience

This constant comparison of different domains of life on social media takes place almost subconsciously. It eventually makes a person look down upon themselves, based on an unreal projection of the life of another person on these public platforms. Similar forms of compulsive conformity can be seen within the household as well. It increases when there are elders involved in the situation because one is expected to accept and uphold their opinions and decisions out of respect and reverence. This is done despite the cognitive dissonance between the two parties or opposing opinions they may possess. This is referred to as obedience and is an example of conformity out of respect.

Over the years, several studies have been conducted to assess the effects of this need for social conformity and cohesion and the peer pressure it leads to. These studies have dealt with understanding its effect on different ages, genders, and social groups. In most cases, this need for cohesiveness has proved detrimental, more specifically in cases related to gender because of the prejudices and the expectation to conform to society’s pre-established gender norms.

Asch’s Conformity Experiment on Groupthink
Lally, M., & Valentine-French, S. (2018). Introduction to Psychology.

Share This Post:

Psychology behind attitude, madras hc orders state to provide lifelong care for 20-year-old with bipolar disorder, leave feedback about this cancel reply.

Rating 5 4 3 2 1

Cultivating a Compassionate Classroom

Behind the Mask: The Impact of Anonymity and

To be a Polyglot: How it affects Cognitive

10 Things You Didn’t Know About Psychology Before

Precognitive Dreams: Glimpses of What’s to Come

Solomon Asch Theory

November 30, 2023

Explore Solomon Asch's pivotal studies on conformity, revealing how group pressure influences individual judgment and decision-making.

Main, P. (2023, November 30). Solomon Asch Theory. Retrieved from https://www.structural-learning.com/post/solomon-asch-theory

Who was Solomon Asch?

Solomon E. Asch is one of the most influential social psychologists whose theories have continued to shape the psychology landscape. In this article, we will delve into the intricate studies that positioned Asch as a seminal figure in understanding the nuanced forces of peer pressure and the compelling sway of group dynamics.

Asch's experimental forays into conformity not only unveiled the often-unseen influence of the group over the individual but also how compliance weaves into the fabric of societal interactions. We will explore the depths of Asch's insights and examine the experiments that have significantly shaped the field's grasp on social behavior. So, who exactly was Solomon Asch?

Key Insights

Solomon Asch's work fundamentally demonstrates the strong effect of group pressure on an individual's judgments and decisions, showing that people often conform to group opinion even when it contradicts their own senses.
His experiments on conformity and the power of majority influence reveal the tension between independence and the need for social acceptance , highlighting the role of normative influence in social settings.
Asch’s findings provide a critical understanding of group dynamics, illustrating how the desire for conformity can lead to the distortion of an individual’s perceptions, cognitions, and behaviors in the presence of a unanimous group consensus.

Solomon Asch's Family Life

Solomon E. Asch, born on September 14, 1907, in Warsaw, Poland, was to become one of the most prominent psychologists of the 20th century, whose work continues to influence our understanding of human behavior in social contexts.

Asch grew up in a family that valued education and intellectual pursuits, which laid the foundation for his lifelong dedication to psychological research. In the early 1920s, Asch's family immigrated to the United States, seeking a new beginning.

This move would prove instrumental in shaping Asch's future career as it provided him with opportunities to engage with diverse cultural and intellectual environments that fueled his curiosity about the human mind.

Asch's Education and Early Career Moves

Solomon Eliot Asch's intellectual journey began earnestly when he attended the City College of New York. His passion for understanding the intricacies of human cognition and behavior led him to pursue further studies at Columbia University, where he was deeply influenced by the teachings of Max Wertheimer, a founder of Gestalt psychology.

Asch's commitment to academic excellence soon earned him a prestigious role as a professor of psychology at Brooklyn College. Here, Asch began to cultivate his interest in the phenomena of social conformity and normative influence.

His scholarly work caught the attention of the psychology department at Harvard University, where Asch continued to explore the powerful impact of social forces on individual judgment. Through meticulous research, Asch sought to unravel the complexities of social conformity, which he believed played a crucial role in everyday life, influencing the decisions and beliefs of individuals within a group setting.

An eminent psychologist, Asch's rigorous studies of independence in perception made significant contributions to the field of social psychology, particularly through his experiments that demonstrated the distortion of judgment under group pressure.

His findings, published in seminal papers in the Journal of Psychology, American Journal of Psychology, Journal of Abnormal and Social Psychology, and the Journal of Social Psychology, highlighted the often underestimated power of conformity and the normative influence it exerts on individuals.

His experiments involved a simple judgment task that provided profound insights into the pressures of conformity. Asch's work illuminated the conditions under which people would ignore their own perceptions to conform with the group, revealing the unexpected and sometimes disturbing ways that group dynamics can influence our perceptions and decisions.

Solomon Asch's work remains a cornerstone in social psychology, emphasizing the importance of understanding the social dimensions of the human mind. His legacy is one of a deep commitment to uncovering the truths of human psychological processes and their manifestations in social settings. As one of the most prominent psychologists, Asch set the stage for decades of research on how social forces shape personal and collective realities .

It's important for us to grasp the historical and biographical context behind such an eminent figure as Asch. To understand the contributions of Solomon Asch is to understand the fundamental ways in which the social world molds our very perceptions and thoughts. As we move forward to explore his contributions to social psychology, we hold this truth at the forefront: the influence of social structures on individual cognition is profound, shaping our world in innumerable ways.

Asch's Conformity Experiments

Asch's Conformity Experiments were conducted to investigate the impact of social pressure on decision-making. The methodology involved a group of participants who were asked to compare the lengths of lines. Unknown to the participant, the other members of the group were confederates instructed to give incorrect answers on some trials. This setup allowed Asch to observe how the participant would respond when faced with a unanimous incorrect answer from the group.

The significance of the critical trials lay in the response of the participant to group pressure. The participant's decision-making was put to the test when the confederates unanimously chose the incorrect line length, and the participant had to decide whether to conform to the group's answer or trust their own judgment.

Asch's experiments revealed that many participants yielded to group pressure, even when they believed the group's answer was incorrect. This demonstrated the powerful influence of social pressure on decision-making. The Asch conformity experiments have had a significant impact on our understanding of conformity and the psychology of group behavior .

Notable Solomon Asch Experiments

Here are a carefully selected list of experiments that showcase Asch's extensive research beyond his renowned conformity studies.

These experiments provide a deeper look into the complexities of social influence, examining the effects of majority opinions on individual judgment and the conditions under which independence from group pressure can be maintained.

Each study offers valuable insights into the mechanisms of social psychology that govern human behavior and social interactions.

Effects of Group Pressure upon the Modification and Distortion of Judgments : In this experiment, Asch explored the influence of group pressure on the alteration of judgments, demonstrating that individuals would often change their answers to align with the group, even when the group was incorrect.
Studies on Independence and Conformity: A Minority of One Against a Unanimous Majority : Here, Asch investigated the power of a single dissenting opinion against a majority, revealing that one individual with a differing viewpoint could inspire others to resist conforming.
Opinions and Social Pressure : Asch conducted a series of experiments examining how individuals' opinions are influenced by the views of a group. He found that social forces significantly shape one’s expressions and beliefs.
The Doctrine of Suggestion, Prestige and Imitation in Social Psychology : This experiment delved into the concepts of suggestion and imitation, where Asch examined the impact of an authoritative figure’s opinion on the subject’s responses.
The Principle of Associative Symmetry : Asch studied associative learning and symmetry, investigating how subjects associated words and whether there was a natural tendency to perceive relationships in a symmetrical manner.

The Asch Paradigm: Understanding Peer Pressure

The Asch Paradigm is a fundamental study in understanding peer pressure in group settings. Asch's experiments demonstrated how individuals are influenced by the majority opinion of a group, even when it conflicts with their own judgment.

This highlights the significance of social pressure on individual decision-making and the factors that lead to conformity within a group. Asch found that the size of the majority, the unanimity of the majority, and the public or private nature of the response all played a role in influencing an individual's level of conformity to group norms.

The Asch Effect, a term coined to describe the impact of group influence on individual judgment and behavior, reveals the power of social pressure in shaping people's actions. This has significant implications for understanding how peer pressure can lead individuals to conform to group norms, even when they personally disagree.

The Asch Paradigm sheds light on the dynamics of social influence, providing valuable insights into the mechanisms of conformity and the pressures individuals face in group settings.

Asch's Legacy in Social Psychology

Solomon Asch's legacy in social psychology is monumental and multifaceted, influencing a broad spectrum of research and theory in the field. Here’s a list detailing the breadth of his impact:

Stanley Milgram's Obedience Studies : Inspired by Asch's famous conformity experiments, Stanley Milgram explored the limits of obedience to authority, revealing unsettling truths about the power of situational factors over individual morality.
Impression Formation Research : Asch's work on impressions of personality provided a foundation for understanding how people form impressions of others—a crucial aspect of Person perception and social interaction.
Development of Social Psychology Experiments : His methodology set a standard for conducting social psychology experiments, particularly those involving college students, which has been emulated in countless studies on conformity and group influence.
Influence on Educational Resources : His findings are prominently featured in educational materials, including publications by Oxford University Press, shaping the curriculum for psychology students worldwide.
Advancement in Social Cognition : Asch's insights into the mechanisms of social influence informed the burgeoning field of social cognition , particularly how individuals perceive and interpret social information.

Solomon Asch’s legacy is enduring, with his work continuing to inform and inspire new generations of psychologists. Asch's contributions have been a beacon, guiding the study of social processes and the intricate dance between individual volition and social forces.

Asch's Influence on Group Dynamics Research

Solomon Asch's conformity experiments have had a significant influence on group dynamics research. His studies demonstrated the power of social influence and the tendency for individuals to conform to the opinions of a majority group. Asch's work sparked a wave of research into group dynamics, including investigations into factors that influence conformity, such as group size, unanimity, and confidence levels.

However, Asch's experiments have also faced criticisms and alternative interpretations. Some researchers have questioned the ecological validity of the Asch experiments, arguing that they may not accurately represent real-world group dynamics. Others have suggested that individual differences and personality traits play a role in shaping conformity behaviors, which may have been overlooked in Asch's studies.

The lasting impact of the Asch Effect on our understanding of social influence and group behavior is undeniable. His work has deepened our understanding of how individuals are influenced by group pressure, and has prompted further research into the complex dynamics of social influence. The Asch Effect remains a foundational concept in the study of group behavior and continues to inform our understanding of conformity and social influence in various contexts.

The Psychology of Compliance

The psychology of compliance refers to the tendency to conform to the norms and behaviors of a social group, even when it contradicts our own beliefs or perceptions. Asch's research on conformity demonstrated the powerful influence of social factors, particularly peer pressure, on our perception of the world. Participants in Asch's experiments often conformed to the group's incorrect judgments, illustrating the impact of social influence on individual behavior.

The relationship between the individual and the social group is complex. The social group can heavily influence an individual's behavior, as demonstrated by Asch's research. However, individuals also have the potential to influence the group through their actions and decisions. Understanding this dynamic is crucial in recognizing the role of social factors in shaping our compliance with group norms and expectations.

In conclusion, compliance is deeply influenced by social factors and peer pressure, as evidenced in Asch's groundbreaking research. The individual's behavior is shaped by the social group, but individuals also have the ability to influence and shape the group. This intricate relationship underscores the power of social factors in our perception and behavior .

Enhance Learner Outcomes Across Your School

Download an Overview of our Support and Resources

We'll send it over now.

Please fill in the details so we can send over the resources.

What type of school are you?

We'll get you the right resource

Is your school involved in any staff development projects?

Are your colleagues running any research projects or courses?

Do you have any immediate school priorities?

Please check the ones that apply.

Download your resource

Thanks for taking the time to complete this form, submit the form to get the tool.

Elevator Groupthink: An Ingenious 1962 Psychology Experiment in Conformity

By maria popova.

The psychology of conformity is something we’ve previously explored, but its study dates back to the 1950s, when Gestalt scholar and social psychology pioneer Solomon Asch , known today as the Asch conformity experiments . Among them is this famous elevator experiment, originally conducted as a part of a 1962 Candid Camera episode titled “Face the Rear.”

Ultimately, diversity contributes not just by adding different perspectives to the group but also by making it easier for individuals to say what they really think. […] Independence of opinion is both a crucial ingredient in collectively wise decisions and one of the hardest things to keep intact. Because diversity helps preserve that independence, it’s hard to have a collectively wise group without it.”

Perhaps the role of the global Occupy movement and other expressions of contemporary civic activism is that of a cultural confederate, spurring others — citizens, politicians, CEOs — to face the front of the elevator at last.

Complement with How To Be a Nonconformist , a satirical masterpiece from the same era, written and illustrated by a teenage girl.

HT Not Exactly Rocket Science

— Published January 13, 2012 — https://www.themarginalian.org/2012/01/13/asch-elevator-experiment/ —

www.themarginalian.org

PRINT ARTICLE

Email article, filed under, activism history knowledge politics psychology vintage, view full site.

The Marginalian participates in the Bookshop.org and Amazon.com affiliate programs, designed to provide a means for sites to earn commissions by linking to books. In more human terms, this means that whenever you buy a book from a link here, I receive a small percentage of its price, which goes straight back into my own colossal biblioexpenses. Privacy policy . (TLDR: You're safe — there are no nefarious "third parties" lurking on my watch or shedding crumbs of the "cookies" the rest of the internet uses.)

Reference Library

Collections

See what's new
All Resources
Student Resources
Assessment Resources
Teaching Resources
CPD Courses
Livestreams

Study notes, videos, interactive activities and more!

Psychology news, insights and enrichment

Currated collections of free resources

Browse resources by topic

All Psychology Resources

Resource Selections

Currated lists of resources

Study Notes

Conformity - Asch (1951)

Last updated 6 Sept 2022

Share on Facebook
Share on Twitter
Share by Email

Asch (1951) conducted one of the most famous laboratory experiments examining conformity. He wanted to examine the extent to which social pressure from a majority, could affect a person to conform.

Asch’s sample consisted of 50 male students from Swarthmore College in America, who believed they were taking part in a vision test. Asch used a line judgement task, where he placed on real naïve participants in a room with seven confederates (actors), who had agreed their answers in advance. The real participant was deceived and was led to believe that the other seven people were also real participants. The real participant always sat second to last.

In turn, each person had to say out loud which line (A, B or C) was most like the target line in length.

Unlike Jenness’ experiment , the correct answer was always obvious. Each participant completed 18 trials and the confederates gave the same incorrect answer on 12 trials, called critical trials. Asch wanted to see if the real participant would conform to the majority view, even when the answer was clearly incorrect.

Asch measured the number of times each participant conformed to the majority view. On average, the real participants conformed to the incorrect answers on 32% of the critical trials. 74% of the participants conformed on at least one critical trial and 26% of the participants never conformed. Asch also used a control group, in which one real participant completed the same experiment without any confederates. He found that less than 1% of the participants gave an incorrect answer.

Asch interviewed his participants after the experiment to find out why they conformed. Most of the participants said that they knew their answers were incorrect, but they went along with the group in order to fit in, or because they thought they would be ridiculed. This confirms that participants conformed due to normative social influence and the desire to fit in.

Evaluation of Asch

Asch used a biased sample of 50 male students from Swarthmore College in America. Therefore, we cannot generalise the results to other populations, for example female students, and we are unable to conclude if female students would have conformed in a similar way to male students. As a result Asch’s sample lacks population validity and further research is required to determine whether males and females conform differently

Furthermore, it could be argued that Asch’s experiment has low levels of ecological validity . Asch’s test of conformity, a line judgement task, is an artificial task, which does not reflect conformity in everyday life. Consequently, we are unable to generalise the results of Asch to other real life situations, such as why people may start smoking or drinking around friends, and therefore these results are limited in their application to everyday life.

Finally, Asch’s research is ethically questionable. He broke several ethical guidelines , including: deception and protection from harm . Asch deliberately deceived his participants, saying that they were taking part in a vision test and not an experiment on conformity. Although it is seen as unethical to deceive participants, Asch’s experiment required deception in order to achieve valid results. If the participants were aware of the true aim they would have displayed demand characteristics and acted differently. In addition, Asch’s participants were not protected from psychological harm and many of the participants reporting feeling stressed when they disagreed with the majority. However, Asch interviewed all of his participants following the experiment to overcome this issue.

Normative Social Influence
Task Difficulty

Ethics and psychology, role of social influence processes in social change, explanations for obedience - milgram (1963), misleading information – post-event discussion, free resource: creating evaluation burgers in the classroom.

12th January 2017

Conformity in Action: Why Our Friends Want Us to Drink?

18th January 2017

Conformity & Minority Influence: Example Answer Video for A Level SAM 2, Paper 1, Q3 (7 Marks)

Topic Videos

Explanations for Conformity Application Essay: Example Answer Video for A Level SAM 3, Paper 1, Q3 (16 Marks)

Our subjects.

› Criminology
› Economics
› Geography
› Health & Social Care
› Psychology
› Sociology
› Teaching & learning resources
› Student revision workshops
› Online student courses
› CPD for teachers
› Livestreams
› Teaching jobs

Boston House, 214 High Street, Boston Spa, West Yorkshire, LS23 6AD Tel: 01937 848885

› Contact us
› Terms of use
› Privacy & cookies

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Publications
Account settings

Preview improvements coming to the PMC website in October 2024. Learn More or Try it out now .

Advanced Search
Journal List
PMC10686423

The power of social influence: A replication and extension of the Asch experiment

Axel franzen.

Institute of Sociology, University of Bern, Bern, Switzerland

Sebastian Mader

Associated data.

The data used in this study is publicly available in the repository of the University of Bern at https://boris.unibe.ch/id/eprint/169645 .

In this paper, we pursue four goals: First, we replicate the original Asch experiment with five confederates and one naïve subject in each group (N = 210). Second, in a randomized trial we incentivize the decisions in the line experiment and demonstrate that monetary incentives lower the error rate, but that social influence is still at work. Third, we confront subjects with different political statements and show that the power of social influence can be generalized to matters of political opinion. Finally, we investigate whether intelligence, self-esteem, the need for social approval, and the Big Five are related to the susceptibility to provide conforming answers. We find an error rate of 33% for the standard length-of-line experiment which replicates the original findings by Asch (1951, 1955, 1956). Furthermore, in the incentivized condition the error rate decreases to 25%. For political opinions we find a conformity rate of 38%. However, besides openness, none of the investigated personality traits are convincingly related to the susceptibility of group pressure.

1. Introduction

A core assumption in sociology is that what humans think and do does not only depend on their own attitudes and disposition, but also to a large extent on what others think and do. The power of social influence on individuals’ behavior was demonstrated already in the 1950s in a series of experiments by Solomon Asch [ 1 – 3 ]. Asch invited individuals into the lab and assigned them the task of judging the length of a line. He also placed 6 confederates into the lab who were assigned to give wrong answers publicly, so that the naïve subject could hear them before he provided his own answer. The results were very surprising: on average 35% of the real subjects followed the opinions of the confederates even if their answer was obviously wrong. The work of Asch has attracted a great amount of attention in the social sciences. Hence, a multitude of replications, extensions, and variations of the original studies have been conducted. However, many of these replications were done with student samples in the US, and fewer studies consist of samples from other countries. Furthermore, many replications were undertaken in the 40 years following the original experiment of Asch, but there are fewer replications thereafter. This raises two important questions: First, are the findings of Asch universal or do they predominantly apply to American students? And second, are the findings still valid today or has the influence of others diminished over time, for instance through increased education and democratization?

Moreover, many experiments in psychology are not incentivized by monetary rewards. This is also true for Asch’s original experiments and for most replications of it. However, in real life outside the lab, decisions are usually associated with consequences, either pleasant in the form of rewards, or unpleasant in the form of some kind of punishment. To make the study of decision-making more realistic, experiments in economics usually use monetary incentives [ 4 ]. To provide a conforming but wrong judgment in the original Asch experiment has no consequences, giving rise to the interesting question of whether the finding of Asch still holds when correct answers are rewarded. So far, the effect of incentives in the Asch decision situation has only been investigated rarely [ 5 – 7 ], with inconclusive evidence. Baron et al. [ 5 ] report that use of monetary incentives actually increased conformity when the task was difficult. A decreased conformity rate was only found in situations with easy tasks. Bhanot & Williamson [ 6 ] conducted two online experiments and found that incentivizing correct answers increases the number of conforming answers. Fujita and Mori [ 7 ] compared group reward and individual rewards in the Asch experiment and found that conformity vanished in the individual reward condition. Thus, the existing evidence on the role of incentives is inconclusive, calling for further investigations of the effect of incentives.

Of course, misjudging the length of lines when others do is not important in itself; the Asch experiment created so much attention because it elicits the suspicion that social influence is also present in other and more important social realms, for instance when it comes to political opinions. Early research by Crutchfield [ 8 ] suggests that the original findings on line judgment also transfer over to political opinions. We are only aware of one further study by Mallinson and Hatemi [ 9 ] that investigates the effect of social influence on opinion formation. However, the authors used a group discussion in the treatment condition, and hence diverged somewhat from the original Asch design. Furthermore, investigations of the effect of social conformity on political opinions are always idiosyncratic making further replications on the transferability from lines to a variety of political opinions important and interesting.

Moreover, behaving in a conforming way and misjudging tasks raises a number of interesting questions. About one third of Asch’s subjects was susceptible to social pressure on average. The rest solved the task correctly irrespective of the confederates’ opinion most of the time. How do those who are not influenced by the group differ from the ones that behave in a conformative manner? Crutchfield [ 8 ] investigated a number of personality traits such as competence, self-assertiveness, or leadership ability on the susceptibility to the pressure to conform to the groups’ judgment. However, many of the measurement instruments used by him or by others [ 10 , 11 ] investigating similar questions are suboptimal, and furthermore produced inconclusive results. Hence, it is worthwhile to further investigate the characteristics of those who conform to social pressure and of those who resist it. We are particularly interested in the Big Five, intelligence, self-esteem, and the need for social approval.

The remainder of the article proceeds in four sections. First, in section two, we present an elaborate literature review of the original Asch experiment, and its various replications. Section three describes how we conducted the replication of the Asch experiment and its variant by using political opinions. Furthermore, we describe how we implemented the incentives, and how we measure the various traits that are presumably related to behavior in the Asch experiment. Section four presents the results and section five concludes and discusses ideas for further research.

2. Literature review

In Asch’s [ 2 ] original experiment 6 to 8 confederates gathered in an experimental room and were instructed to give false answers in matching a line with the length of three reference lines. An additional uninstructed subject was invited into the experimental room and asked to provide his judgment after the next to last of the confederates. Asch [ 2 ] reports a mean error rate of 36.8% of the 123 real subjects in the critical trials in which the group provided the wrong answer. This result was replicated remarkably consistently. Bond and Smith [ 12 ] conducted a meta study including 44 strict replications, and report an average error rate of 25%. As with the study by Asch [ 2 ], the vast majority of these replications were conducted with male university students in the US. However, more recent studies from Japan [ 13 , 14 ], and Bosnia and Herzegovina [ 15 ] also confirm Asch’s findings. Takano and Sogon [ 14 ] found an error rate of 25% in male Japanese university students (n = 40) in groups with 6 to 9 confederates. Mori and Arai [ 13 ] used the fMORI technique in which participants wear polarized sunglasses allowing the perception of different lines from the same presentation. The method allows to abandon the use of confederates in the Asch judgment task. They replicated the conformity rate for Japanese female subjects (N = 16) but found no conformity for male subjects (N = 10). Usto et al. [ 15 ] found an error rate of 35% in 95 university students of both sexes from Bosnia and Herzegovina with five confederates per group. Other studies also show that subjects are influenced by groups, when the confederates provided their judgments anonymously or with respect to different judgment tasks such as judging the size of circles, completing rows of numbers, or judging the length of acoustic signals [ 8 , 12 , 16 – 21 ]. More recent studies conducted the Asch experiment also with children [ 22 – 25 ] suggesting that the conformity effect can also be found in preschool children. However, some studies also found age effects, such that younger children conformed to the groups majority judgment, but the effect decreases for adolescents [ 26 , 27 ]. To summarize, given the results of the literature, we expect to find a substantial conformity rate in the replication of the original Asch line experiment (H 1 ).

2.1 Monetary incentives

An important extension of the original Asch experiment is the introduction of incentives. In everyday life, decisions are usually associated with consequences. However, in the Asch experiment, as in many other experiments in psychology, decisions or behavior in the lab usually have no consequences, besides of standing out in the laboratory group. This raises questions of the external validity of non-incentivized experiments. Theoretically, it can be expected that correct judgments are less important if they are not incentivized. This could imply that the findings of the Asch experiment are partly methodological artifacts. So far there is only limited and inconclusive empirical evidence with respect to monetary incentives in the Asch experiment. Early studies analysed the role of the perceived societal or scientific importance of the task [ 20 ]. Later research incentivized correct answers in various conformity experiments. Andersson et al. [ 28 ] report that individual incentives decreased the effect of conformity on the prediction of stock prices. However, Bazazi et al. [ 29 ] report the opposite. They found that individualized incentives increase conformity in comparison to collective payoffs in an estimation task. In the study of Baron et al. [ 5 ] 90 participants solved two eyewitness identifications tasks (a line-up task and a task of describing male figures) in the presence of two unanimously incorrectly-answering confederates. Additionally, task importance (low versus high) and task difficulty (low versus high) were experimentally manipulated resulting in a 2 x 2 between subject design. Subjects in the high task importance condition received $20 if ranked in the top 12% of participants with regard to correct answers. Subjects in the low task importance condition received no monetary incentive for correct answers. The results of Baron et al. [ 5 ] show a conformity rate that closely replicates Asch’s [ 1 – 3 ] finding in the condition without monetary incentives. In the condition including a monetary incentive for correct answers, conformity rates drop by about half to an error rate of 15%. However, this result only emerges in the condition with low task difficulty. For the high task difficulty condition, the opposite effect of monetary incentives was observed. Thus, monetary incentives increased conformity when the task was difficult and decreased conformity in situations with easy tasks. However, one drawback of the study of Baron et al. [ 5 ] is a rather low sample size, which might explain the differential effects by experimental condition.

Fujita and Mori [ 7 ] analysed the effect of individual vs collective payoff in the Asch experiment. They found that the conformity effect disappears in the individually incentivized condition. However, also this study suffered from low sample sizes since there were only 10 subjects in the individualized minority incentive condition. Furthermore, Fujita and Mori [ 7 ] used the fMORI method and report that some subjects might have noticed the trick.

Bhanot and Williamson [ 6 ] conducted online experiments (using Amazon Mechanical Turk) in which 391 participants answered 60 multiple-choice trivia-knowledge questions while the most popular answer was displayed at each question. Correct answers were incentivized randomly with $0, $1, $2 or $3 each in a within-subject design, i.e. randomized over trials, not over subjects. Bhanot and Williamson [ 6 ] found that monetary incentives increase the proportion of answers that align with the majority. Hence, the studies using incentives yield inconclusive and contradicting results: Particularly, Baron et al. [ 5 ] found both an accuracy-increasing and accuracy-decreasing effect of monetary incentives depending on task difficulty. Bhanot and Williamson [ 6 ] found an increased conformity rate, and Fujita and Mori [ 7 ] found that the conformity bias disappears in the individually incentivized condition. Overall, we follow the economic notion that monetary incentives matter and expect that rewards for nonconformity decrease group pressure (H 2 ).

2.2 Political opinions

Another critical question is, whether matters of fact can be generalized to matters of attitude and opinion. Crutchfield [ 8 ] investigated experimentally the influence of social pressure on political opinions in an Asch-like situation. He found that agreement with the statement “Free speech being a privilege rather than a right, it is proper for a society to suspend free speech whenever it feels itself threatened” was almost 40 percentage points higher in the social pressure condition (58%, n = 50) than in the individual judgment condition (19%, n = 40). Furthermore, he observed a difference of 36%-points if the confederates answer “subversive activities” to the question "Which one of the following do you feel is the most important problem facing our country today? Economic recession, educational facilities, subversive activities, mental health or crime and corruption” as compared to an individual judgment condition (48% vs 12%). However, the results are based on a rather small number of cases and decisions were anonymous, unlike the original design of Asch.

To the best of our knowledge, there is only one further study that experimentally investigates the influence of social pressure on opinions regarding political issues in an Asch-like situation. In the study of Mallinson and Hatemi [ 9 ] participants (n = 58) were asked to give their opinion on a specific local political issue before and after a 30–45 minutes face-to-face group discussion (treatment condition). In the control condition subjects received written information that contradicts their initial opinion. They found that in the control condition only 8% changed their initial opinion when provided with further information, while in the treatment condition 38% of subjects changed their opinion. Yet, in this recent study the sample size is also rather small. To sum up, given the results of these two studies, we expect that groups exert influence also on political opinions (H 3 ).

2.3 Individual differences

Crutchfield [ 8 ] was also the first who investigated the relationship between personality traits and the susceptibility to the pressure of conformity. He found that low conformity rates were related to high levels of intellectual competence, ego strength, leadership ability, self-control, superiority feelings, adventurousness, self-assertiveness, self-respect, tolerance of ambiguity, and freedom from compulsion regarding rules. High levels of conformity were observed for subjects with authoritarian, anxious, distrustful, and conventional mindsets. However, no substantial correlation was found for neuroticism. Obviously, Crutchfield’s [ 8 ] study is limited by a rather low number of subjects (N = 50). Moreover, the measurement instruments used may be debatable from a contemporary point of view. We are aware of one more recent study with a sufficiently high number of study subjects and more rigid measurement instruments to test the influence of personality traits on conformity in Asch-like situations: Kosloff et al. [ 19 ] analysed the association of the Big Five personality traits (agreeableness, conscientiousness, extraversion, neuroticism, and openness) with conformity in public ratings of the humorousness of unfunny cartoons in 102 female college students. Kosloff et al. [ 19 ] found that subjects with low neuroticism, high agreeableness, and high conscientiousness scores show high levels of conformity. Extraversion, and openness were not associated with conformity ratings. Beyond that, we are not aware of any more studies that investigate the influence of the Big Five personality traits in the original Asch situation. However, there is evidence that openness is linked to nonconformity. Eck and Gebauer [ 30 ] argue that “open people engage in independent thought and, thus, rely little on the conformity heuristic”.

Crutchfield [ 8 ] studied the effect of intellectual competence on conformity. He found that higher competence was associated with lower levels of conformity. However, intelligence was measured by the subjective ratings of the experimental staff. Iscoe, Williams, and Harvey [ 10 ] exposed high school students (7 to 15 years) to group pressure in an acoustic task (counting metronome ticks), and approximated intelligence by subjects’ school records. They found no correlation of school records with conformity. Uchida et al. [ 31 ] studied 12 to 14 year-old high school students and assessed scholastic achievements by their school performance. They report that high achievers conformed less to the majority than low achievers. Hence, results of the effect of intelligence on conformity are inconclusive so far and the existing studies use indirect measures (school grades) but do not measure intelligence directly.

The effect of self-esteem (or self-assertiveness, self-consciousness) on conformity was only investigated in a few studies so far. Kurosawa [ 11 ] found no effect on conformity when the decision of the minority subject was preceded by two confederates. In groups of four, confederates’ self-esteem had a negative effect on conformity. Similarly, Tainaka et al. [ 32 ] found in a sample of Japanese female students that those with low self-esteem conformed more often in a co-witness task.

In addition, the need for social approval may explain individual differences in conformity behavior. The urge to please others by adhering to social norms is expected to be positively related to conformity, simply because conformity is socially approved in many situations and because of a general tendency among humans toward acquiescence. Once more, Crutchfield [ 8 ] provided the first hints of a positive relationship between the need for social approval and conforming behavior in an anonymous Asch situation. However, the measurement instrument he used is debatable. Strickland and Crowne [ 33 ] confirmed Crutchfield’s [ 8 ] finding in a sample of 64 female students exposed to an Asch-like acoustic judgment task using the Crowne-Marlowe (CM) social desirability scale [ 34 , 35 ] to gauge the need for social approval. Again, we are not aware of any other more recent study on this aspect. Hence, we investigate the association of the need for social approval using the CM social desirability scale as well as a more recent and supposedly more appropriate instrument to capture the need for social approval [ 36 ]. Summarizing, we expect to find a positive association between social approval and conformity (H 4 ), and negative associations for intelligence (H 5 ) and self-esteem (H 6 ). With respect to the Big Five we follow Eck and Gebauer [ 30 ] and expect a negative relation between openness and conformity (H 7 ).

Finally, Crutchfield [ 8 ] also analysed the influence of gender on conformity in a sample of 40 female and 19 male college students (study two). He found that young women show higher conformity rates than young men. Yet, in a third study he found that female college alumnae (N = 50) show lower conformity rates than in study one. Hence, Crutchfield’s [ 8 ] findings for the gender effect are inconclusive. However, Bond and Smith [ 12 ] report in their meta-analysis higher conformity rates for females. The study by Griskevicius et al. [ 18 ] shows that gender-differences in conformity depend on the activation of behavioral motives. Men who were primed to attract a mate revealed more independent judgments than women primed to attract a mate, supposedly because of differing mating preferences in men and women. Therefore, we wonder, whether we can replicate the finding that females are more conformative than males in the Asch experiment.

3. Design and method

3.1 procedure and materials.

The experiment consisted of three parts. Part 1 was designed to replicate the original Asch experiment. For this purpose, we recruited 210 subjects on the campus of the University of Bern. Informed consent was obtained verbally before participants entered the experimental room. We randomized subjects into two groups. In group one subjects had to judge the length of lines, as in the original Asch experiment. For this purpose, we placed 5 confederates in addition to a naïve subject in a room. The confederates were asked to behave as naïve subjects and entered the room one after the other. The front row of the seats in the experimental room were numbered such that subjects sat next to each other. The naïve subject was always assigned to seat number 5, leaving the last seat to another confederate. First, we presented some instructions to the subjects: “Welcome to our study on decision-making behavior and opinions. This study consists of two parts: In the first part in this room, we ask you to solve a total of 10 short tasks. In the second part in the room next door, we ask you to complete a short questionnaire on the laptop. In total, this study takes about 40 minutes. As compensation for your participation, you will receive 20 Swiss francs in cash after completing the study.” We then presented a reference line to subjects next to three other lines that were numbered 1 through 3 on projected slides. Subjects were asked to judge the length of the reference line by naming the number of the line that corresponds to the reference line in length. We presented 10 such line tasks (see Fig A1 in the S1 Appendix ). In the first two trials as well as in trials number 4 and 8, confederates pointed out the correct lines. Four trials were easy tasks, since the difference between the reference line and two of the other lines was large. The other six trials were more difficult, since the differences were small. Subjects were asked to call out the number of the correct line always starting with subject 1 through 6.

After the line task in part 2 of the experiment subjects were confronted with 5 general questions on different political issues. The statements were selected because we believe they describe fundamental attitudes towards different political or social groups in a democracy. The five statements read (1) “Do you think that the Swiss Federal Government should be given more power?”, (2) “Do you think trade unions should be given more power in Switzerland?”, (3) “Do you think that the employers’ association in Switzerland should be given more power?”, (4) “Do you think that citizens should be given more liberties in Switzerland?”, and (5) “Do you think that companies in Switzerland should be given more freedom?”. Subjects were asked to answer all 5 questions with either yes or no. The confederates in this group were instructed to answer “yes” to the first question and “no” to the rest. We chose this sequence of “yes” and “no” to prevent that subjects discover the existence of confederates. Finally, part 3 of the experiment consisted of an online questionnaire which subjects were asked to complete. To conceal that some participants were confederates all 6 participants were accompanied to separate rooms where the online-questionnaire was installed on a laptop. The questionnaire was designed to measure a number of different personality traits. Particularly, we measured the Big Five using a 10-item scale (two items for each of the 5 traits) as suggested by Rammstedt et al. [ 37 ] (see Table A1 in the S1 Appendix for item wording); a 10-item scale measuring self-esteem as suggested by Rosenberg [ 38 ] (see Table A2 in the S1 Appendix ); a short version of the Hagen Matrices Test [ 39 ] to measure intelligence and the 10-item version of the Martin Larson Approval Motivation Scale (MLAM) [ 36 ].

In group 2 the experimental design and procedure was the same as in group 1 besides the fact that correct answers in the length of lines judgment task were incentivized. In addition to the 20 Swiss francs show-up fee, subjects received one Swiss franc for every correct answer in the line judgment task, and hence, could earn up to 30 Swiss francs in total. Since there are no correct answers to political opinions these were not incentivized. However, we randomized the confederates’ answers to political opinion questions independently of whether a subject was in the incentivized or non-incentivized group. In one version confederates answered “yes” to the first question and “no” to the four other questions. In the other version the sequence of the confederates’ response was “no” to the first question and “yes” in response to the other four. The experiment was conducted by three different research teams consisting of 7 student assistants each. In every group 5 students acted as confederates and 2 as research assistants, recruiting subjects, welcoming and instructing them in the laboratory room, and reading out loud the projected instructions.

A power analysis suggested that we need about 100 subjects per experimental condition to find statistically significant (α = 0.05) differences of 5 percentage points for a power of 0.8. Hence, we stopped recruiting subjects after reaching 210 participants. The experiment was conducted between March 16, 2021 and April 30, 2021. The authors had no access to any information that links individual identifiers to the data. Subjects were debriefed after the end of the study by email.

Overall, 210 subjects participated in the experiment (female = 61%, mean age = 22.6). 102 subjects were randomly assigned to the non-incentivized group and 108 into the group with incentives. Moreover, 113 subjects were assigned to the sequences of “yes” and four “no” of the political opinion task and 97 to the reversed sequence, suggesting that the randomization procedure worked well. The questionnaire also contained an attention check. The question reads “In the following we show you five answer categories. Please do not tick any of the answers”. Four subjects failed to comply and ticked an answer, suggesting that they did not pay proper attention to the question wording. These subjects were excluded from the analysis. Furthermore, we asked subjects at the end of the questionnaire what they think the experiment was about. Three subjects recognized that the experiment was the line task experiment of Asch or expressed the suspicion that some of the other group members were confederates. We also excluded these three subjects from the analysis. Moreover, one subject answered the question about their gender with “other” and was also excluded from the analysis. Hence, these exclusions result in 202 valid cases. However, the results presented do not depend on these eight excluded observations.

Fig 1 presents the results of the ten line length tasks for the non-incentivized (grey bars) and for the incentivized conditions (blue bars). As can be clearly seen, almost none of the naïve subjects gave an incorrect answer when the group provided the correct answer which was the case in decision situations 1, 2, 4 and 8. However, when the group provides the false answer a substantial number of naïve subjects provided this incorrect answer as well (decision situations 3, 5, 6, 7, 9, and 10). The proportion of incorrect answers in the non-incentivized condition is relatively small in decision 3 (10%), but relatively high in decisions number 6 and 7 (44% and 47%). The average of incorrect answers is 33% in the non-incentivized group, which is a perfect replication of Asch’s (1955) original 36.8% result (two sample two-sided T-test, t(16) = 0.59, p = 0.57).

An external file that holds a picture, illustration, etc.
Object name is pone.0294325.g001.jpg

Note: Percent of correct answers by experimental group and trial including 95% confidence intervals. The numbers on top of the bars denote the trial numbers. “correct” stands for uncritical trials, “false” for critical trials. “easy” denotes easy trials with big differences between the lines, and “hard” denotes more difficult trials with smaller differences between the lines. The numbers between the bars denote the difference in proportions between the groups in percentage points. One-sided T-tests: * = p < 0.05. N without incentive (no) = 99, n with incentive (yes) = 103.

When correct answers are incentivized, the proportion of incorrect answers decreases by on average 8%-points. The difference between the groups is statistically significant in 2 out of 6 critical trials (p < 0.05 for one-sided T-tests). The difference also becomes evident when we consider the number of incorrect answers in the 6 critical trials. When decisions were not incentivized subjects gave on average 1.97 incorrect answers. In the incentivized condition the average number dropped to 1.47, leading to a statistically significant difference of 0.5 incorrect answers (t(208) = 2.24, p = 0.03 for two-sided T-test).

Next, Fig 2 presents the results concerning the five political questions. When the group said “yes” to the question of whether the Swiss Federal Council (the government in Switzerland) should have more power, 27% of the naïve subjects did so as well. When the group said “no” only 3% of the subjects said “yes” resulting in a difference of 23.4%-points. When the group said that trade unions should have more power 72% of the subjects answered “yes” as compared to only 29% when the group said “no” resulting in a difference of 43%-points. Similarly, the question of whether the employers’ association should have more power is agreed to by 44% and 6% respectively, depending on the group agreeing or disagreeing. Moreover, 81% of the subjects agreed that citizens in Switzerland should be given more liberties when the group does so, and 33% agreed to this question when the group says “no”. Finally, 46% said that companies should be given more freedom when the group agreed but only 8% did so when the group denied this question. The average difference in the proportion of yes-answers is 38%-points and all 5 differences are statistically highly significant. This result corresponds astonishingly close to the result in the length of line experiment and suggests that the influence of group pressure can be generalized to the utterance of political opinions.

An external file that holds a picture, illustration, etc.
Object name is pone.0294325.g002.jpg

Note: Percent of ‘yes’ answers to five general questions on political opinions in which all confederates answered uniformly ‘yes’ or ‘no’, by experimental group including 95% confidence intervals. The numbers on top of the bars stand for the difference in proportions between the respective groups in percentage points. Two-sided T-tests: *** = p < 0.001. n (sequence yes, no, no, no, no) = 109, n (sequence no, yes, yes, yes, yes) = 93.

One interesting question is whether the susceptibility to group pressure is linked to certain personality traits. To investigate this question, we count the number of wrong answers in the six critical trials of the length of line task. This variable is our dependent variable and runs from 0 when a subject always gave correct answers to 6 for subjects who gave only wrong answers. First, we wondered whether conformity is linked to the Big Five personality traits. We measured the Big Five using a short 10-item version as suggested by Rammstedt et al. [ 37 ] which measures each trait (openness, extraversion, agreeableness, conscientiousness, and neuroticism) with two questions (see Table A1 in the S1 Appendix ).

Second, we incorporate a 10-item measure of self-esteem, as suggested by Rosenberg [ 38 ], into the analysis (see Table A2 in the S1 Appendix ). Each item of the scale has four answer categories ranging from 1 = “disagree strongly”, 2 = “disagree”, 3 = “agree” to 4 = “agree strongly”. Subjects that score high on self-esteem are expected to have stronger confidence in their own perception and should be less influenced by the group’s opinion. Third, we measured individuals’ intelligence using a short version of the Hagen Matrices Test (HMT) [ 39 ]. The HMT consists of six 9-field matrices that show graphical symbols that follow a logical order. The last field is missing and the task of the subjects is to pick the correct symbol, out of eight, that fits and completes the pattern of the matrix. Hence, the HMT ranges from 0 if no answer is correct to 6 for subjects who provided six correct answers. The hypothesis is that subjects who score high on the HMT are less susceptible to the pressure of the group and also provide more correct answers in the line task.

Finally, conformity might be linked to the need for social approval. We measured the need for social approval with a 10-item version of the Martin Larson Approval Motivation Scale (MLAM) [ 36 ] (see Table A3 in the S1 Appendix ). Individuals that score highly on the MLAM display high need for social approval by others. Hence, we expect that subjects with higher values on the MLAM should also conform more often to the opinions of others in order to receive social approval. A summary of the descriptive information of the considered variables is depicted in Table A4 in the S1 Appendix . To investigate whether any of the measured personality traits are linked to the answering behavior in the line task we conducted multiple OLS regression analysis. The results of this analysis are depicted in the coefficient plots in Fig 3 (see also Table A5 in the S1 Appendix ).

An external file that holds a picture, illustration, etc.
Object name is pone.0294325.g003.jpg

Note: N = 202. Unstandardized coefficients of multiple linear OLS regressions including robust 95% confidence intervals. Poisson and negative binomial models do not alter the results in any substantial way. Variables marked with an ‘*’ indicate statistically significant differences in the coefficients between models (2) and (3).

First, model 1 presents the effects on the number of conforming answers for the whole sample. In the incentivized condition subjects gave on average 0.43 fewer conforming answers as compared to the unincentivized condition. This effect mirrors the bivariate result already presented in Fig 1 and is statistically significant for the 5% level. In tendency, females show more conforming answers, but this effect is statistically only significant for the 10% level. Besides “openness” none of the personality traits contained in the Big Five show any statistically significant effects. This is also true for the other effects of intelligence, self-esteem, and the measure for social approval seeking. Models 2 and 3 show the results for men and women separately. The separate results suggest that women react somewhat more strongly to incentives than do men. However, a test for differences in coefficients suggests that the effects do not differ (χ 2 (1) = 1.11, p = 0.29). Intelligence seems to have greater importance for men, leading to 0.27 fewer conforming answers for every correct answer of the HMT. However, this effect does not differ statistically from the effect for females (χ 2 (1) = 1.35, p = 0.25). No difference in effects can be observed for self-esteem. However, in the female sample the need for social approval is positively linked to the number of conforming answers, which is not the case in the male sample (χ 2 (1) = 4.23, p = 0.04); but the effect of social approval in the female sample is relatively small.

We conducted a number of robustness checks with the presented analyses. Since our dependent variable is a count variable (number of conforming answers) the models can also be estimated using Poisson regressions or negative-binomial models. However, none of our presented results change in any substantial way using these alternatives. Furthermore, we excluded 24 more subjects who when asked at the end of the experiment about the goal of the study said that the experiment was about group pressure or conformity, although they did not explicitly mention Asch or the suspicion that other participants were confederates. But these additional exclusions also did not change the results substantially (see Table A6 in the S1 Appendix ). Finally, we also incorporated the 10-item version of the Marlowe-Crowne Scale [ 34 , 35 ] suggested by Clancy [ 40 , 41 ]. However, inclusion of the scale did not show any statistically significant effects or did change any of the other estimates.

5. Conclusion and discussion

In this study we first replicated the original experiment of Asch [ 1 – 3 ] with 5 confederates and ten line tasks. We find an average error rate of 33% which replicates the original findings of Asch very closely and which is in line with other replications that were conducted predominately with American students [ 12 ]. Together with recent studies from Japan [ 14 ], and Bosnia and Herzegowina [ 15 ], our study provides further evidence that the influence of groups on individuals’ judgments is a universal phenomenon, and is still valid today. Furthermore, we incentivized the decisions and find a drop of the error rate by 8%-points to 25%. Hence, monetary incentives do not eliminate the effect of group pressure. This finding sheds doubt on former results which predominately show the opposite effect, namely that incentives increase compliance [ 5 , 6 ].

Moreover, our study suggests that group pressure is not only influential in the simple line task but also when it comes to political opinions. We randomized the groups’ response to five different political statements and find an average conformity rate of 38%. Hence, these results suggest that the original finding of Asch can also be generalized to matters of opinion. This result is in line with former evidence by Crutchfield [ 8 ], and Mallinson and Hatemi [ 9 ]. However, both of these studies had only small sample sizes of 50 and 58 subjects respectively, which called for further replication studies. Finally, we measured the Big Five, intelligence, self-esteem and social approval. With the exception of openness, our study finds no support that these personality traits are statistically significantly related to the susceptibility of group pressure.

Of course, our study has some limitations, which suggest a number of further research questions. First, we used a relatively large sample of 202 subjects providing more statistical power than former replications and extensions of the Asch experiment; however, our subjects were also students, and hence, it would be important to have further replications with non-student samples. This would allow further investigations of the susceptibility to group pressure with respect to age, different occupational groups, different social backgrounds, and different levels of social experience.

Second, the subjects we investigate are strangers. That means the single naïve subjects did not know the confederates. An interesting question for further research would be, whether group pressure is stronger among non-strangers or whether dissent becomes more acceptable among a group of friends.

Third, we demonstrate that monetary incentives reduce the error rate. However, our incentives were one Swiss franc for every correct answer, and hence small. Thus, the interesting question remains whether larger incentives reduce the error rate further, or can even lead to the elimination of it.

Fourth, the political statements we choose are relatively moderate and general. This leaves the question open as to whether subjects would also conform to more extreme or socially less acceptable statements. Furthermore, our subjects might have rarely thought about the statements we provided, leaving the question of what would happen with respect to statements about which subjects had stronger opinions or which are more related to their identity.

With the exception of openness all personality traits considered (e.g. intelligence, self-esteem, need for social approval) are not related to conformity. This raises a number of very interesting research questions. One possibility is that the traits were not measured good enough, and that measurement errors impede the identification of these individual differences. This concern applies particularly to the measurement of the Big Five where we relied on the short 10-item version suggested by Rammstedt et al. [ 37 ]. Hence, the puzzling result that openness leads to less conformity must be replicated before it can count as a reliable finding. However, the finding is in line with the assumption of Eck and Gebauer [ 30 ]. Another possibility is that other personality traits are more important when it comes to conformity behavior. Hence, there is much room for further interesting research concerning conformity behavior in situations of group pressure.

Supporting information

S1 appendix, acknowledgments.

We like to thank our student assistants for helping us with the data collection. Their names are: Yvonne Aregger, Elias Balmer, Ambar Conca, Davide Della Porta, Shania Flück, Julian Gerber, Anna Graf, Ina Gutjahr, Kim Gvozdic, Anna Häberli, Chiara Heiss, Paula Kühne, Jenny Mosimann, Remo Parisi, Elena Raich, Virginia Reinhard, Fiona Schläppi, Maria Tournas, Angela Ventrici, Marco Zbinden, Sarah Zwyssig.

Funding Statement

The author(s) received no specific funding for this work.

Data Availability

IEEE Account

Change Username/Password
Update Address

Purchase Details

Payment Options
Order History
View Purchased Documents

Profile Information

Communications Preferences
Profession and Education
Technical Interests
US & Canada: +1 800 678 4333
Worldwide: +1 732 981 0060
Contact & Support
About IEEE Xplore
Accessibility
Terms of Use
Nondiscrimination Policy
Privacy & Opting Out of Cookies

A not-for-profit organization, IEEE is the world's largest technical professional organization dedicated to advancing technology for the benefit of humanity. © Copyright 2024 IEEE - All rights reserved. Use of this web site signifies your agreement to the terms and conditions.

Social Conformity and Group Pressure

Looking at social, psychological, and cultural explanations..

Posted May 21, 2023 | Reviewed by Jessica Schrader

Solomon Asch is considered the pioneer of experiments related to the impact of social pressure on conformity.
The extent of conformity has been found to be influenced by factors like culture.
Awareness of when conformity can be optimal or detrimental can protect individuals from group pressure.

By Varun Ramgopal, Research Affiliate at the Department of Psychology, Monk Prayogshala

What causes individuals to conform to the opinions and judgments of others? Why do they need to? When is it an advantage to merge with the group and when is it not? Investigating the social, psychological, and cultural characteristics of conformity is critical to understanding the extent to which group pressure can modify and distort individual judgment and decision-making . Substantial research, starting with Solomon Asch’s line judgment experiments, has been pursued over the last seven decades to arrive at potential explanations for people’s urge to conform to the majority, while ignoring the unambiguity of their individual perceptual judgments.

In an Asch-style social conformity experiment, seven or eight participants are seated in a room, required to perform a line-judgment task. This task entails reporting which line out of three lines shown on Card 2 is of the same length as that of a single line shown on Card 1. The correct response on each trial is meant to be unambiguous to the normal eye such that the absence of any group pressure would typically result in minimal to no erroneous responses. However, in order to test the influence of social pressure on people’s tendency to conform, these experiments typically involve a single real participant with all the other participants being instructed by the experimenter to play confederates. These confederates unanimously and deliberately disagree with the original participant on certain trials, causing the participant to be torn between their perceptual evidence and the unanimous dissent of the group.

Asch found that an appreciable percentage of individuals submitted to the majority. While interviewed following the experiment, participants who predominantly conformed indicated their lack of confidence in the evidence of their senses and greater confidence in the claims that others made. Surprisingly, there were participants who reported that they yielded to the majority despite believing with certainty that the majority dissenting was incorrect. A meta-analytic review revealed that a larger size of the majority, similarity of the respondent with the majority, a higher proportion of female participants, and a smaller average discrepancy between the original participant’s response and that of the majority were significantly and positively associated with conformity. The (greater) effort that non-conformity might involve with respect to forming individual opinions and convincing others in the group about the validity of one’s judgment could also lead to higher levels of conformity.

Cultural differences in social conformity

Studies aimed at investigating the relationship between culture and conformity have primarily focussed on making comparisons between individualistic and collectivist societies. According to Hofstede , individualistic structures entail ascribing greater importance to individual goals , self-actualization, autonomy, and uniqueness. Collectivism, on the other hand, focuses on the well-being and interdependence of social entities such as families and friendships. In a collectivist culture, the individual strives for the benefit and welfare of the social unit rather than just focusing on individual achievement. Examples of countries that have a collectivist structure in place could include Asian countries such as China, India, Japan, and South Korea, among others (MasterClass, 2022a). Countries such as the United States, the United Kingdom, Australia, and New Zealand, among other countries, are considered to have individualistic cultures (MasterClass, 2022b).

With regard to the association between culture and conformity, the hypothesis would be that higher levels of social conformity would be found in collectivist structures compared to conformity in individualistic structures. A rationale for this hypothesis would be that individuals coming from collectivist countries could be more inclined to ascribe greater importance to social opinion and blend with the majority while those from individualistic countries would be more willing to establish their autonomic decision-making abilities and uniqueness.

A meta-analysis undertaken on the replications of Asch’s line-judgment task across 17 countries confirms the hypothesis stated above: individualistic cultures exhibit lower levels of conformity than collectivist cultures. From a cultural perspective, by relating this finding to some of the moderator variables that have been found to impact conformity, one could argue that individuals from geographies that prioritize social unity may feel a greater need to conform when the size of the majority increases. Similarly, with respect to similarities between the focal participant and the majority, individuals coming from the same cultural background (in-group) would be more likely to conform with each other than with members from another cultural context (out-group).

Other studies that have not used Asch’s line judgment experiment to investigate the cultural element of conformity also report similar findings. Comparing the choices of East Asian and British students in a lottery choice task, a study found that British students were more likely to deviate from the choices made by the majority, comprising peers. Findings from the same study also revealed that with an increase in the size of the majority, East Asian students were more likely to conform in comparison to the choices made by Australians. In another analysis using archival data sources, the authors found that the online review ratings of restaurants provided by individuals from collectivist backgrounds were in concurrence with prior ratings compared to the ratings of those coming from individualistic backgrounds.

Considering individuals’ general tendency to submit to the majority in the group pressure experiments discussed above, with cultural differences in the inclination to conform, there is one question that demands attention : Is it always detrimental to conform to social opinions? For example, in the context of health care, one would be better off consciously discerning, conforming to, and spreading information on the effectiveness of preventive health-related behaviours and vaccines rather than conforming to conspiracy theories that emerge against these beneficial preventive measures. In social contexts such as the one created in the Asch line judgment task, it may pay off to consciously remind oneself of the fact that just because one is part of the minority, it does not necessarily imply that they are incorrect. Such explicit awareness could help individuals to make rational decisions and enhance their individual fitness in an evolutionary sense.

MasterClass. (2022a, November 9). Collectivist Culture: Pros and Cons of a Collectivist Culture - 2023 - MasterClass . https://www.masterclass.com/articles/collectivist-culture

MasterClass. (2022b, November 13). Individualistic Culture Explained: Pros and Cons of Individualism - 2023 - MasterClass . https://www.masterclass.com/articles/individualistic-culture

Monk Prayogshala Research Institution is a not-for-profit academic research institution in Mumbai, India.

Find a Therapist
Find a Treatment Center
Find a Psychiatrist
Find a Support Group
Find Online Therapy
United States
Brooklyn, NY
Chicago, IL
Houston, TX
Los Angeles, CA
New York, NY
Portland, OR
San Diego, CA
San Francisco, CA
Seattle, WA
Washington, DC
Asperger's
Bipolar Disorder
Chronic Pain
Eating Disorders
Passive Aggression
Personality
Goal Setting
Positive Psychology
Stopping Smoking
Low Sexual Desire
Relationships
Child Development
Self Tests NEW
Therapy Center
Diagnosis Dictionary
Types of Therapy

Sticking up for yourself is no easy task. But there are concrete skills you can use to hone your assertiveness and advocate for yourself.

Emotional Intelligence
Gaslighting
Affective Forecasting
Neuroscience

Bipolar Disorder
Therapy Center
When To See a Therapist
Types of Therapy
Best Online Therapy
Best Couples Therapy
Managing Stress
Sleep and Dreaming
Understanding Emotions
Self-Improvement
Healthy Relationships
Student Resources
Personality Types
Sweepstakes
Guided Meditations
Verywell Mind Insights
2024 Verywell Mind 25
Mental Health in the Classroom
Editorial Process
Meet Our Review Board
Crisis Support

Biography of Psychologist Solomon Asch

Asch conducted influential experiments on conformity

Birth and Death

Asch's Conformity Experiments

Contributions to Psychology

Selected publications.

Solomon Asch was a pioneering 20th century social psychologist who is perhaps best remembered for his research on the psychology of conformity . Asch took a Gestalt approach to the study of social behavior, suggesting that social acts needed to be viewed in terms of their setting. His famous conformity experiment demonstrated that people would change their response due to social pressure in order to conform to the rest of the group.

"The human mind is an organ for the discovery of truths rather than of falsehoods." —Solomon Asch

Solomon Eliot Asch was born September 14, 1907, in Warsaw, Poland.
He died February 20, 1996, in Haverford, Pennsylvania at the age of 88.

Solomon Asch was born in Warsaw but emigrated to the United States in 1920 at the age of 13. His family lived in the Lower East Side of Manhattan and he learned English by reading the works of Charles Dickens.

Asch attended the College of the City of New York and graduated with his bachelor's degree in 1928. He then went to Columbia University, where he was mentored by Max Wertheimer and earned his master's degree in 1930 and his PhD in 1932.

Asch's Conformity Experiments

During the early years of World War II when Hitler was at the height of power, Solomon Asch began studying the impact of propaganda and indoctrination while he was a professor at Brooklyn College's psychology department. He also served as a professor for 19 years at Swarthmore College, where he worked with renowned Gestalt psychologist Wolfgang Köhler.

Asch is one of many psychology researchers who generated new ideas about human psychology in response to the events of World War II. Others include Victor Frankl, the father of logotherapy .

It was during the 1950s when Asch became famous for his series of experiments (known as the Asch conformity experiments ) that demonstrated the effects of social pressure on conformity. Just how far would people go to conform to others in a group? Asch's research demonstrated that participants were surprisingly likely to conform to a group, even when they personally believed that the group was incorrect. From 1966 to 1972, Asch held the title of director and distinguished professor of psychology at the Institute for Cognitive Studies at Rutgers University.

Solomon Asch is considered a pioneer of social psychology and Gestalt psychology. His conformity experiments demonstrated the power of social influence and still serve as a source of inspiration for social psychology researchers today. Understanding why people conform and under what circumstances they will go against their own convictions to fit in with the crowd not only helps psychologists understand when conformity is likely to occur but also what can be done to prevent it.

Asch also supervised Stanley Milgram's Ph.D. at Harvard University and inspired Milgram's own highly influential research on obedience . Milgram's work helped demonstrate how far people would go to obey an order from an authority figure.

While Asch's work illustrated how peer pressure influences social behavior (often in negative ways), Asch still believed that people tended to behave decently towards each other. The power of situations and group pressure, however, could often lead to less than ideal behavior and decision-making.

In a 2002 review of some of the most eminent psychologists of the 20th century, Asch was ranked as the 41st most-frequently cited psychologist.

Below are some of Asch's most important published works. His most prominent publications are from the 1950s and the time of his experiments in conformity.

Asch, S. E. (1951). Effects of group pressure upon the modification and distortion of judgment . In H. Guetzkow (ed.) Groups, leadership, and men . Pittsburgh, PA: Carnegie Press.
Asch, S. E. (1955). Opinions and social pressure . Scientific American , 193, 31-35.
Asch, S. E. (1956). Studies of independence and conformity: A minority of one against a unanimous majority . Psychological Monographs, 70 (Whole no. 416).
Asch, SE (1987). Social Psychology . Oxford University Press. ISBN 0198521723

Morgan TJ, Laland KN. The biological bases of conformity . Front Neurosci . 2012;6:87. doi:10.3389/fnins.2012.00087

Asch SE. Effects of group pressure upon the modification and distortion of judgments . In: Guetzkow H, ed., Groups, leadership and men; research in human relations. Pittsburgh PA: Carnegie Press; 1951.

Swarthmore College. 1951 Psychologist Solomon Asch's Famous Experiments .

University of Pennsylvania. Death of Solomon Asch . Almanac. 1996 ;42:23

McCauley C, Rozin P. Solomon Asch: Scientist and humanist . In: Kimble GA, Wertheimer M, eds., Portraits of pioneers in psychology, Vol. 5. Mahwah, NJ: Lawrence Erlbaum Associates Publishers; 2003.

Milgram S. Behavioral study of obedience . J Abnorm Soc Psychol. 1963;67 (4), 371–378. doi:10.1037/h0040525

Haggbloom SJ, Warnick R, Warnick JE, et al. The 100 most eminent psychologists of the 20th century . Review of General Psychology . 2002;6(2):139-152. doi:10.1037/1089-2680.6.2.139

Rock, Irvin, ed. The Legacy of Solomon Asch: Essays in Cognition and Social Psychology . Hillsdale, New Jersey: Lawrence Erlbaum Associates. ISBN 0805804404; 1990.

Stout, D. Solomon Asch Is Dead at 88; A Leading Social Psychologist. The New York Times ; 1996.

By Kendra Cherry, MSEd Kendra Cherry, MS, is a psychosocial rehabilitation specialist, psychology educator, and author of the "Everything Psychology Book."

What Is Conformity? Definition, Types, Psychology Research

Saul McLeod, PhD

Editor-in-Chief for Simply Psychology

BSc (Hons) Psychology, MRes, PhD, University of Manchester

Saul McLeod, PhD., is a qualified psychology teacher with over 18 years of experience in further and higher education. He has been published in peer-reviewed journals, including the Journal of Clinical Psychology.

Learn about our Editorial Process

Olivia Guy-Evans, MSc

Associate Editor for Simply Psychology

BSc (Hons) Psychology, MSc Psychology of Education

Olivia Guy-Evans is a writer and associate editor for Simply Psychology. She has previously worked in healthcare and educational sectors.

On This Page:

Conformity is a type of social influence involving a change in belief or behavior in order to fit in with a group.

This change is in response to real (involving the physical presence of others) or imagined (involving the pressure of social norms/expectations) group pressure.

Conformity can also be simply defined as “ yielding to group pressures ” (Crutchfield, 1955). Group pressure may take different forms, for example bullying, persuasion, teasing, criticism, etc. Conformity is also known as majority influence (or group pressure).

The term conformity is often used to indicate an agreement to the majority position, brought about either by a desire to ‘ fit in ’ or be liked (normative) or because of a desire to be correct (informational), or simply to conform to a social role (identification).

Jenness (1932) was the first psychologist to study conformity. His experiment was an ambiguous situation involving a glass bottle filled with beans.

He asked participants individually to estimate how many beans the bottle contained. Jenness then put the group in a room with the bottle and asked them to provide a group estimate through discussion.

Participants were then asked to estimate the number on their own again to find whether their initial estimates had altered based on the influence of the majority.

Jenness then interviewed the participants individually again and asked if they would like to change their original estimates or stay with the group’s estimate. Almost all changed their individual guesses to be closer to the group estimate.

However, perhaps the most famous conformity experiment was by Solomon Asch (1951) and his line judgment experiment.

Types of Conformity

Kelman (1958) distinguished between three different types of conformity:

Compliance (or group acceptance)

This occurs “when an individual accepts influence because he hopes to achieve a favorable reaction from another person or group. He adopts the induced behavior because….he expects to gain specific rewards or approval and avoid specific punishment or disapproval by conformity” (Kelman, 1958, p. 53).

In other words, conforming to the majority (publicly) in spite of not really agreeing with them (privately). This is seen in Asch’s line experiment .

Compliance stops when there are no group pressures to conform and is, therefore, a temporary behavior change.

Internalization (genuine acceptance of group norms)

This occurs “when an individual accepts influence because the content of the induced behavior – the ideas and actions of which it is composed – is intrinsically rewarding . He adopts the induced behavior because it is congruent [consistent] with his value system” (Kelman, 1958, p. 53).

Internalization always involves public and private conformity. A person publicly changes their behavior to fit in with the group while also agreeing with them privately.

This is the deepest level of conformity, where the beliefs of the group become part of the individual’s own belief system. This means the change in behavior is permanent. This is seen in Sherif’s autokinetic experiment.

This is most likely to occur when the majority has greater knowledge and members of the minority have little knowledge to challenge the majority’s position.

Identification (or group membership)

This occurs “when an individual accepts influence because he wants to establish or maintain a satisfying self-defining relationship to another person or group” (Kelman, 1958, p. 53).

Individuals conform to the expectations of a social role, e.g., nurses and police officers.

It is similar to compliance as there does not have to be a change in private opinion. A good example is Zimbardo’s Prison Study .

Ingratiational

This is when a person conforms to impress or gain favor/acceptance from other people.

It is similar to normative influence but is motivated by the need for social rewards rather than the threat of rejection, i.e., group pressure does not enter the decision to conform.

Why Do People Conform?

Deutsch and Gerrard (1955) identified two reasons why people conform :

Normative Conformity

Yielding to group pressure because a person wants to fit in with the group. E.g., Asch Line Study.
Conforming because the person is scared of being rejected by the group.
This type of conformity usually involves compliance – where a person publicly accepts the views of a group but privately rejects them.

Informational Conformity

This usually occurs when a person lacks knowledge and looks to the group for guidance.
Or when a person is in an ambiguous (i.e., unclear) situation and socially compares their behavior with the group. E.g., Sherif’s Study.
This type of conformity usually involves internalization – where a person accepts the views of the groups and adopts them as an individual.

Conformity Examples

Sherif (1935) autokinetic effect experiment.

Aim : Sherif (1935) conducted an experiment with the aim of demonstrating that people conform to group norms when they are put in an ambiguous (i.e., unclear) situation.

Method : Sherif used a lab experiment to study conformity. He used the autokinetic effect – this is where a small spot of light (projected onto a screen) in a dark room will appear to move even though it is still (i.e., it is a visual illusion).

It was discovered that when participants were individually tested, their estimates of how far the light moved varied considerably (e.g., from 20cm to 80cm).

The participants were then tested in groups of three. Sherif manipulated the composition of the group by putting together two people whose estimate of the light movement when alone was very similar and one person whose estimate was very different. Each person in the group had to say aloud how far they thought the light had moved.

Results : Sherif found that over numerous estimates (trials) of the movement of light, the group converged to a common estimate. The person whose estimate of movement was greatly different from the other two in the group conformed to the view of the other two.

Sherif said that this showed that people would always tend to conform. Rather than make individual judgments, they tend to come to a group agreement.

Conclusion : The results show that when in an ambiguous situation (such as the autokinetic effect), a person will look to others (who know more / better) for guidance (i.e., adopt the group norm). They want to do the right thing but may lack the appropriate information. Observing others can provide this information. This is known as informational conformity.

Non Conformity

Not everyone conforms to social pressure. Indeed, there are many factors that contribute to an individual’s desire to remain independent of the group.

For example, Smith and Bond (1998) discovered cultural differences in conformity between western and eastern countries. People from Western cultures (such as America and the UK) are more likely to be individualistic and don’t want to be seen as being the same as everyone else.

This means that they value being independent and self-sufficient (the individual is more important than the group) and, as such, are more likely to participate in non-conformity.

In contrast, eastern cultures (such as Asian countries) are more likely to value the needs of the family and other social groups before their own. They are known as collectivist cultures and are more likely to conform.

Asch, S. E. (1951). Effects of group pressure upon the modification and distortion of judgments. In H. Guetzkow (Ed.), Groups, leadership and men . Pittsburg, PA: Carnegie Press.

Crutchfield, R. (1955). Conformity and Character. American Psychologist , 10, 191-198.

Deutsch, M., & Gerard, H. B. (1955). A study of normative and informational social influences upon individual judgment . The journal of abnormal and social psychology, 51(3) , 629.

Jenness, A. (1932). The role of discussion in changing opinion regarding a matter of fact. The Journal of Abnormal and Social Psychology , 27, 279-296.

Kelman, H. C. (1958). Compliance, identification, and internalization: three processes of attitude change . Journal of Conflict Resolution, 2, 51–60.

Mann, L (1969). Social Psychology . New York: Wiley.

Sherif, M. (1935). A study of some social factors in perception. Archives of Psychology , 27(187) .

Smith, P. B., & Bond, M. H. (1993). Social Psychology Across Cultures: Analysis and Perspectives . Hemel Hempstead: Harvester Wheatsheaf.

cropped Screenshot 2023 08 20 at 23.18.57

Teenage Stress and Peer Pressure: Understanding and Overcoming Social Influences

Whispers, sidelong glances, and the ever-present ping of social media notifications form an invisible web that ensnares teenagers in a daily tug-of-war between conformity and individuality. This constant struggle is at the heart of peer pressure, a powerful force that shapes the teenage experience and significantly impacts adolescent stress levels. As teenagers navigate the complex social landscape of their formative years, they often find themselves caught between the desire to fit in and the need to establish their unique identity.

Peer pressure, broadly defined, is the influence exerted by a peer group that encourages individuals to change their attitudes, values, or behaviors to conform to the group’s norms. During the teenage years, this influence becomes particularly potent as adolescents seek acceptance and validation from their peers. The prevalence of peer pressure during this developmental stage is nearly universal, affecting teenagers across cultures and socioeconomic backgrounds.

The relationship between peer pressure and stress is intricate and multifaceted. While not all peer influence is negative, the constant pressure to meet social expectations can create a significant burden on teenagers’ mental and emotional well-being. Alarming Teen Stress Statistics: Understanding the Silent Epidemic reveal that a substantial portion of adolescents report feeling overwhelmed by the demands placed upon them by their peer groups.

Types of Peer Pressure and Their Influence on Teens

To fully grasp the impact of peer pressure on teenage stress, it’s essential to understand the various forms it can take. Peer pressure manifests in several ways, each with its unique challenges and potential consequences.

Direct peer pressure is perhaps the most recognizable form. It involves explicit requests or demands from peers to engage in specific behaviors or conform to certain standards. This type of pressure can be particularly stressful for teenagers who may feel cornered or coerced into making decisions that conflict with their personal values or judgment.

Indirect peer pressure, on the other hand, operates through subtle social cues and expectations. This form of influence is often more pervasive and challenging to resist, as it doesn’t involve direct confrontation. Instead, teenagers may feel compelled to adopt certain behaviors or attitudes simply by observing and internalizing the norms of their peer group.

In the digital age, a new form of peer pressure has emerged: digital peer pressure. Social media platforms and online interactions have created an environment where teenagers are constantly exposed to the curated lives of their peers. This continuous stream of information can lead to heightened feelings of inadequacy and the pressure to present a perfect online persona.

It’s important to note that not all peer pressure is negative. Positive peer pressure can encourage teenagers to strive for academic excellence, engage in healthy behaviors, or participate in community service. However, even positive peer influence can contribute to stress if it creates unrealistic expectations or pushes teenagers beyond their comfort zones.

Ways Peer Influence Increases Teenage Stress

The influence of peers permeates various aspects of teenage life, often leading to increased stress levels. Understanding the Top 3 Cognitive Stressors for Teens: A Comprehensive Guide to Mental Stress in Adolescents highlights how peer pressure can exacerbate existing stressors and create new ones.

Academic pressure and competition are significant sources of stress for many teenagers. The desire to match or surpass the academic achievements of their peers can lead to intense pressure to perform. This competitive atmosphere can result in sleepless nights, anxiety about grades, and a constant fear of falling behind.

Social expectations and the need to fit in are at the core of peer-induced stress. Teenagers often feel compelled to dress, speak, and behave in ways that align with their peer group’s norms. This pressure to conform can be particularly stressful for those who feel at odds with these expectations or struggle to find their place within social circles.

Peer influence can also lead to engagement in risky behaviors and substance use. The desire to be seen as cool or adventurous may push teenagers to experiment with alcohol, drugs, or other dangerous activities. The stress of navigating these situations, coupled with the potential consequences, can be overwhelming for many adolescents.

Body image and appearance-related stress are amplified by peer pressure, especially in the age of social media. Teenagers are bombarded with images of idealized beauty standards, leading to increased dissatisfaction with their own appearance. This constant comparison can result in low self-esteem, disordered eating habits, and a preoccupation with physical appearance.

The fear of missing out (FOMO) and the expectation of constant connectivity add another layer of stress to teenage life. Social media platforms create a sense that everyone else is always having fun or achieving success. This perception can lead to anxiety about being left out and a compulsive need to stay connected at all times.

Psychological and Physiological Effects of Peer-Induced Stress

The stress resulting from peer pressure can have profound psychological and physiological effects on teenagers. 10 Crucial Signs of Stress in Teens: Recognizing and Addressing the Silent Struggle outlines various indicators that parents and educators should be aware of.

Anxiety and depression are common psychological consequences of peer-induced stress. The constant pressure to meet social expectations and the fear of rejection can lead to persistent feelings of worry and sadness. In severe cases, this may develop into clinical anxiety disorders or major depressive episodes.

Low self-esteem and self-doubt often accompany peer pressure-related stress. When teenagers consistently feel that they don’t measure up to their peers’ standards, it can erode their confidence and sense of self-worth. This negative self-perception can have long-lasting effects on their personal and professional lives.

Sleep disturbances and fatigue are physiological manifestations of stress that many teenagers experience. The pressure to balance social expectations, academic demands, and extracurricular activities can lead to irregular sleep patterns and chronic exhaustion. This lack of adequate rest can further exacerbate stress and impair cognitive function.

Chronic stress resulting from peer pressure can also lead to various physical health issues. These may include headaches, digestive problems, weakened immune function, and even cardiovascular issues in the long term. 10 Surprising Facts About Teenage Stress: Understanding the Modern Adolescent Experience delves deeper into the physical toll that stress can take on adolescents.

The impact of peer-induced stress on decision-making and cognitive function is significant. Under constant pressure, teenagers may struggle to think clearly, make rational decisions, or focus on important tasks. This cognitive impairment can affect their academic performance, personal relationships, and overall well-being.

Recognizing and Addressing Peer Pressure-Related Stress

Identifying the signs of unhealthy peer influence is crucial for both teenagers and the adults in their lives. Some indicators include sudden changes in behavior, withdrawal from family and longtime friends, a decline in academic performance, or expressions of anxiety about social situations.

Effective communication is key to addressing peer pressure-related stress. Teenagers should be encouraged to express their concerns and feelings openly. Creating a safe, non-judgmental environment where they can discuss their experiences without fear of reprisal is essential.

Building resilience and self-confidence is vital in helping teenagers withstand peer pressure. This involves fostering a strong sense of self, encouraging the development of personal values, and helping teens recognize their unique strengths and abilities.

Developing healthy coping mechanisms is another crucial aspect of managing peer-induced stress. This may include engaging in physical exercise, practicing mindfulness or meditation, pursuing creative outlets, or seeking support from trusted friends and family members.

Parents and educators play a significant role in supporting teenagers as they navigate peer pressure. Understanding the Stress of Adolescence: Why Teenagers Face Turbulent Times can help adults empathize with the challenges teens face and provide appropriate guidance and support.

Strategies for Teens to Manage Peer Pressure and Reduce Stress

Empowering teenagers with effective strategies to manage peer pressure is essential for reducing stress and promoting overall well-being. Here are some key approaches that can help adolescents navigate social influences more effectively:

Setting personal boundaries and learning to say ‘no’ is a fundamental skill for managing peer pressure. Teenagers should be encouraged to identify their limits and values, and to assert themselves when faced with situations that make them uncomfortable. Role-playing exercises can be helpful in practicing these skills in a safe environment.

Choosing positive peer groups and influences can significantly impact a teenager’s stress levels. Encouraging involvement in clubs, sports teams, or community organizations can help adolescents connect with like-minded peers who share similar values and interests.

Practicing mindfulness and stress-reduction techniques can provide teenagers with valuable tools for managing peer-induced stress. Techniques such as deep breathing exercises, progressive muscle relaxation, and guided imagery can help reduce anxiety and promote a sense of calm in challenging situations.

Seeking support from trusted adults or professionals is crucial when peer pressure becomes overwhelming. Teenagers should be encouraged to reach out to parents, teachers, school counselors, or mental health professionals for guidance and support. The Hidden Toll: Academic Pressure and Its Impact on Student Mental Health underscores the importance of professional support in managing stress.

Engaging in extracurricular activities and hobbies can provide a healthy outlet for stress and help teenagers develop a sense of identity outside of their peer group. These pursuits can boost self-esteem, provide a sense of accomplishment, and offer opportunities to form friendships based on shared interests rather than social pressure.

The Role of Academic Pressure in Peer-Induced Stress

While social factors play a significant role in peer pressure, it’s important to recognize the impact of academic expectations on teenage stress levels. Understanding and Overcoming Academic Pressure: A Comprehensive Guide explores this topic in depth, highlighting how the competitive nature of education can exacerbate peer-induced stress.

In many peer groups, academic achievement is highly valued, leading to intense competition among students. This pressure to excel can lead to unhealthy study habits, sleep deprivation, and anxiety about grades and test scores. The fear of falling behind or being perceived as less intelligent than one’s peers can be a significant source of stress for many teenagers.

Moreover, the pressure to secure admission to prestigious colleges or universities adds another layer of stress to the academic experience. Teenagers may feel compelled to participate in numerous extracurricular activities, take advanced courses, or achieve perfect grades to keep up with their high-achieving peers.

It’s crucial for educators and parents to promote a balanced approach to academic success, emphasizing personal growth and learning over competition and comparison. Encouraging collaboration rather than competition among peers can help reduce stress and foster a more supportive learning environment.

The Interplay of Positive and Negative Stressors in Adolescence

Understanding the complex interplay between positive and negative stressors is essential for a comprehensive view of teenage stress. Navigating Positive and Negative Stressors in Middle School: A Comprehensive Guide provides insights into how different types of stress affect adolescents.

While negative peer pressure can clearly lead to harmful stress, it’s important to recognize that some forms of peer influence can actually have positive effects on teenagers’ well-being. Surprising Factors That Decrease Adolescent Stress: A Comprehensive Analysis explores elements that can help reduce stress levels in teenagers.

Positive peer pressure can motivate teenagers to set and achieve goals, develop new skills, and engage in prosocial behaviors. For example, having friends who value academic achievement can inspire a student to study harder and perform better in school. Similarly, peers who engage in community service or promote healthy lifestyles can encourage positive behaviors that contribute to overall well-being.

However, it’s crucial to maintain a balance. Even positive influences can become stressful if they create unrealistic expectations or push teenagers beyond their comfort zones too quickly. The key is to foster an environment where teens feel supported in their personal growth without feeling overwhelmed by the pressure to constantly achieve or conform.

The relationship between peer pressure and teenage stress is complex and multifaceted. While peer influence can contribute significantly to adolescent stress levels, it’s important to recognize that not all peer pressure is negative. By understanding the various types of peer pressure and their potential impacts, teenagers, parents, and educators can work together to create supportive environments that promote healthy social interactions and personal growth.

Awareness of the signs of peer-induced stress and proactive stress management strategies are crucial for helping teenagers navigate this challenging period of their lives. By empowering adolescents with the tools to recognize and address peer pressure, we can help them build resilience, maintain their individuality, and make informed choices that align with their personal values and goals.

Ultimately, the goal is to encourage teenagers to embrace their uniqueness while fostering positive relationships with their peers. By striking this balance, we can help reduce the negative impacts of peer pressure and create a more supportive, less stressful environment for adolescents to thrive in.

As we continue to understand and address the challenges faced by today’s teenagers, it’s clear that peer influence will remain a significant factor in their lives. However, with the right support, education, and coping strategies, teenagers can learn to navigate these influences more effectively, reducing stress and building the foundation for a healthy, confident adulthood.

References:

1. Steinberg, L., & Monahan, K. C. (2007). Age differences in resistance to peer influence. Developmental Psychology, 43(6), 1531-1543.

2. Allen, J. P., & Antonishak, J. (2008). Adolescent peer influences: Beyond the dark side. In M. J. Prinstein & K. A. Dodge (Eds.), Understanding peer influence in children and adolescents (pp. 141-160). Guilford Press.

3. Twenge, J. M. (2017). iGen: Why Today’s Super-Connected Kids Are Growing Up Less Rebellious, More Tolerant, Less Happy–and Completely Unprepared for Adulthood–and What That Means for the Rest of Us. Atria Books.

4. Baumeister, R. F., & Leary, M. R. (1995). The need to belong: Desire for interpersonal attachments as a fundamental human motivation. Psychological Bulletin, 117(3), 497-529.

5. Elkind, D. (2001). The Hurried Child: Growing Up Too Fast Too Soon. Da Capo Lifelong Books.

6. Crone, E. A., & Dahl, R. E. (2012). Understanding adolescence as a period of social-affective engagement and goal flexibility. Nature Reviews Neuroscience, 13(9), 636-650.

7. Blakemore, S. J., & Mills, K. L. (2014). Is adolescence a sensitive period for sociocultural processing? Annual Review of Psychology, 65, 187-207.

8. Yeager, D. S., Dahl, R. E., & Dweck, C. S. (2018). Why interventions to influence adolescent behavior often fail but could succeed. Perspectives on Psychological Science, 13(1), 101-122.

9. Telzer, E. H., van Hoorn, J., Rogers, C. R., & Do, K. T. (2018). Social influence on positive youth development: A developmental neuroscience perspective. Advances in Child Development and Behavior, 54, 215-258.

10. Prinstein, M. J., & Giletta, M. (2016). Peer relations and developmental psychopathology. In D. Cicchetti (Ed.), Developmental psychopathology: Theory and method (pp. 527-579). John Wiley & Sons, Inc.

Teen Stress: Causes, Effects, and Coping Strategies for Adolescents

Pressure mounts, hormones rage, and expectations soar as millions of teenagers navigate the minefield of adolescence, desperately seeking relief from the invisible weight crushing their shoulders. This phenomenon, known as teen stress, has become increasingly prevalent in today’s fast-paced, hyper-connected world. As adolescents grapple with the challenges of growing up, they often find themselves overwhelmed…

Middle School Stressors: Navigating Positive and Negative Challenges

Buckle up, tweens and teens—middle school is a stress-filled pressure cooker that can either forge diamonds or crack fragile shells. As young adolescents navigate this crucial period of their lives, they encounter a myriad of stressors, both positive and negative, that shape their experiences and personal growth. Understanding these stressors and learning how to manage…

Early Life Stress: Impact and Strategies for Building Resilience

Like invisible fingerprints on the canvas of our future, childhood stressors leave lasting impressions that shape our adult lives in ways we’re only beginning to unravel. Early life stress, a term encompassing a wide range of adverse experiences during childhood and adolescence, has emerged as a critical area of study in psychology, neuroscience, and public…

Parenting Stress: Coping Strategies for Overwhelmed Parents

Frazzled nerves, endless to-do lists, and a symphony of chaos – welcome to the wild world of parenting, where stress lurks around every sippy cup and unmade bed. Parenting is often described as the most rewarding job in the world, but it’s also one of the most challenging. The constant demands, sleepless nights, and overwhelming…

Stuttering: Causes, Stress, and Management Techniques

Words, like trapped butterflies, sometimes flutter and stutter in our throats, their wings clipped by the invisible strings of stress. This poetic imagery captures the essence of stuttering, a complex speech disorder that affects millions of people worldwide. Stuttering is more than just a momentary hesitation or repetition of sounds; it’s a multifaceted condition that…

Anxiety in Teens: A Comprehensive Guide for Parents and Educators on Understanding and Management

Like a smartphone with too many apps running, the modern teenage mind often crashes under the weight of unchecked anxiety, leaving parents and educators scrambling to reboot their child’s mental well-being. This analogy aptly captures the overwhelming nature of anxiety that many teenagers face in today’s fast-paced, hyper-connected world. As we delve into this critical…

The significance of electrical signals in maturing spermatozoa for phosphoinositide regulation through voltage-sensing phosphatase

Takafumi Kawai ORCID: orcid.org/0000-0001-6632-5551 1 ,
Shin Morioka 2 ,
Haruhiko Miyata ORCID: orcid.org/0000-0003-4758-5803 3 ,
Rizki Tsari Andriani 1 ,
Sharmin Akter ORCID: orcid.org/0000-0001-6901-3377 1 nAff9 ,
Gabriel Toma 4 nAff10 ,
Tatsuya Nakagawa 3 , 5 ,
Yuki Oyama ORCID: orcid.org/0000-0003-4579-5487 3 , 5 ,
Rie Iida-Norita 3 ,
Junko Sasaki 2 ,
Masahiko Watanabe 6 ,
Kenji Sakimura 7 ,
Masahito Ikawa ORCID: orcid.org/0000-0001-9859-6217 3 , 5 ,
Takehiko Sasaki ORCID: orcid.org/0000-0003-1837-3748 2 &
Yasushi Okamura ORCID: orcid.org/0000-0001-5386-7968 1 , 8

Nature Communications volume 15 , Article number: 7289 ( 2024 ) Cite this article

1 Altmetric

Metrics details

Cell signalling
Phospholipids
Reproductive biology

Voltage-sensing phosphatase (VSP) exhibits voltage-dependent phosphatase activity toward phosphoinositides. VSP generates a specialized phosphoinositide environment in mammalian sperm flagellum. However, the voltage-sensing mechanism of VSP in spermatozoa is not yet characterized. Here, we found that VSP is activated during sperm maturation, indicating that electric signals in immature spermatozoa are essential. Using a heterologous expression system, we show the voltage-sensing property of mouse VSP (mVSP). The voltage-sensing threshold of mVSP is approximately −30 mV, which is sensitive enough to activate mVSP in immature spermatozoa. We also report several knock-in mice in which we manipulate the voltage-sensitivity or electrochemical coupling of mVSP. Notably, the V312R mutant, with a minor voltage-sensitivity change, exhibits abnormal sperm motility after, but not before, capacitation. Additionally, the V312R mutant shows a significant change in the acyl-chain profile of phosphoinositide. Our findings suggest that electrical signals during sperm maturation are crucial for establishing the optimal phosphoinositide environment in spermatozoa.

Introduction

The membrane potentials of plasma membranes act as critical “electrical signals”, enabling neurons and other cells to communicate and transmit information. Therefore, the physiological implications of these signals have predominantly been explored in neurons or muscles, with a primary focus on voltage-gated ion channels that modulate ion permeability based on membrane potential 1 . In contrast, our previous work identified a distinctive voltage-sensing phosphatase (VSP) which shows the voltage-dependent phosphatase activity toward phosphoinositides (PIPs). This property is due to the unique architecture of VSP which has a voltage-sensor domain (VSD), phosphatase domain (PD) and VSD-PD linker 2 , 3 . VSD, which is also conserved in the conventional voltage-gated ion channels, consists of four transmembrane helical segments (S1-S4) and the S4 segment contains positive charge residues for sensing the membrane potentials. PD shows similarity to PTEN, which shows phosphatase activities toward PIPs. The VSD-PD linker connects PD with the VSD and plays crucial role in coupling VSD and PD activities. Thus, this unique configuration endows VSP with the capability to voltage-dependently dephosphorylate PIPs, thereby transforming “electrical signals” into “chemical signals” 3 , 4 , 5 , 6 , 7 .

Recently, our study revealed the functional expression of VSP in mouse spermatozoa, elucidating its role in regulating sperm motility during capacitation through analysis of VSP-deficient animal models 8 . VSP induced notable alterations in the PIPs profile of mature spermatozoa, creating a distinctive longitudinal PI(4,5)P 2 (Phosphatidylinositol 4,5-bisphosphate) gradient along the flagella. This specialized PI(4,5)P 2 environment emerged as crucial for modulating the activity of SLO3, a sperm-specific K + channel pivotal for fertilization 8 , 9 , 10 . However, several fundamental questions persist regarding the functional role of VSP in spermatozoa: Does VSP really sense the membrane potential of spermatozoa? If this is the case, what is the mechanism underlying it?

The voltage-dependent enzymatic activity of VSP was initially characterized in Ciona intestinalis (Ci-VSP) using Xenopus oocyte heterologous expression systems 2 . This activity was subsequently identified in vertebrates, including zebrafish (Dr-VSP), African clawed frogs (Xl-VSP), and chickens (Gg-VSP) in vitro 11 , 12 , 13 , 14 . However, attempts to detect voltage-dependent phosphatase activities using mammalian VSPs in heterologous expression systems have been unsuccessful, despite their structural homologies with non-mammalian VSPs 3 , 15 . Consequently, the existence of voltage-sensing capabilities in mammalian VSPs remains uncertain, contributing to a dearth of detailed information regarding the electrophysiological properties of these proteins.

Here, we started our study by investigating the PIPs profile at different stages of sperm maturation. Our findings reveal a progressive impact of VSP on the PIPs profile during sperm maturation, suggestive of continuous VSP activation throughout this long-term process. Additionally, two-electrode voltage clamp (TEVC) analysis of mVSP activity, with modifications to its intracellular linker and N-terminal sequence in a heterologous expression system, indicated that mVSP is activated at approximately −30mV, a membrane potential lower than the resting membrane potential of immature spermatozoa.

Finally, we generated three distinct knock-in mice expressing VSP mutations: (1) loss of voltage-sensing capability (D225R), (2) loss of electrochemical coupling between voltage-sensor and enzyme (K347Q), and (3) slightly altered voltage-dependency (V312R), based on the aforementioned TEVC experiments. While functionally null D225R and K347Q mutant mice abolished VSP expression itself, V312R mutant mice exhibited normal protein expression with significant changes in spermatozoa function. This study provides pioneering insights into the significance of voltage-sensing capabilities of mVSPs in native spermatozoa.

VSP demonstrates phosphatase activity during sperm maturation

Spermatozoa acquire fertility through a maturation process as they traverse from proximal to distal segments of epididymis, i.e., caput, corpus and cauda epididymis (Fig. 1a ). This process is pivotal for optimal sperm function. Notably, the lipid composition of spermatozoa undergoes changes during this process 16 . While the membrane phospholipids contain acyl groups, with two fatty acids located at the sn-1 and sn-2 positions (Supplementary Fig. 1 ), it remains unknown how the profile of acyl chains of PIPs transitions during the maturation process. To elucidate it, we employed liquid chromatography-tandem mass spectrometry (LC-MS/MS) to assess the profiles of PIPs as well as phosphatidylserine (PS) in both caput and cauda epididymal spermatozoa. This method allows for the measurement of both the carbon number and the number of double bonds of the combined acyl groups at the sn-1 and sn-2 positions (Supplementary Fig. 1 ), while it does not separate the isomers of PIP (PI(3)P, PI(4)P, PI(5)P) and PIP 2 (PI(3,4)P 2 , PI(3,5)P 2 , PI(4,5)P 2 ) (Supplementary Fig. 1 ). In line with previous findings 16 , we observed a marked difference in PS composition between caput and cauda spermatozoa (Supplementary Fig. 2a ). While PS contained only a limited set of acyl chain variants (Supplementary Fig. 2a ), PIP and PIP 2 in both caput and cauda spermatozoa exhibited diverse acyl chain variants, particularly enriched in Long-Chain Polyunsaturated Fatty Acids (LC-PUFA) (e.g., 40:5 and 40:6) (Supplementary Fig. 2b, c ). These LC-PUFA variants appear to include docosahexaenoic acid (DHA, 22:6) and docosapentaenoic acid (DPA, 22:5), which are highly prevalent in spermatozoa 17 , 18 . We confirmed the VSP protein expression at caput spermatozoa which is comparable to cauda spermatozoa (Supplementary Fig. 3 ). In cauda epididymis, the total PIP/PIP 2 ratio was significantly higher in mature sperm (cauda) than in immature sperm (caput) in VSP +/- samples (Fig. 1b ). This trend was absent in VSP-deficient samples, suggesting that VSP exerts its phosphatase activity during the maturation process.

a Spermatozoa, which differentiate in the testis, undergo maturation as they are transported through the caput epididymis to the cauda epididymis. By the time they reach the cauda epididymis, they become fully mature and are capable of fertilization. The matured spermatozoa are stored in the epididymal cauda. b PIP/PIP 2 ratio in spermatozoa from caput and cauda epididymis of each genotype mice. The significant difference of PIP/PIP 2 ratio between Vsp +/- and Vsp -/- was already observed in caput epididymal spermatozoa, but the difference is more pronounced in cauda epididymal spermatozoa (Tukey’s multiple comparison test. p -value is adjusted for multiple comparison. ** p < 0.01, **** p < 0.0001, n = 3 independent mice for each group). The exact p -value is shown in the Data Source file. Data are represented as mean ± s.e.m. c – f PRMC-MS analysis was performed at different maturation stages of spermatozoa. The calculated PI(4)P/PI(4,5)P 2 ratios are shown. (unpaired two-sided t-test, ** p < 0.01, *** p < 0.01, **** p < 0.0001). The data from cauda epididymis ( f ) was already reported in the previous study 8 . The experiment group in caput epididymis ( e ) corresponds to the experiment group of “low K + ” shown in Supplementary Fig. 4 . For ( c – f ), n = 5,5,5 and 6 biologically independent mice in each genotype are used, respectively. Data are represented as mean ± s.e.m. The exact p -value is shown in the Data Source file.

Subsequently, we investigated whether short-term alterations in membrane potential influence the PIPs profile using sperm from the caput epididymis. We manipulated the membrane potential of caput epididymal spermatozoa by incubating them in high or low extracellular K + solutions with 10 μM valinomycin for 30 minutes and employed Phosphoinositide Regioisomer Measurement by Chiral column chromatography and Mass Spectrometry (PRMC-MS), which can accurately separate PIPs regioisomers 8 , 19 . No significant difference in PI(4)P/PI(4,5)P 2 ratio was observed between the treatments (Supplementary Fig. 4 ), suggesting that a short-time electric signal is not sufficient and prolonged VSP activation is required for exhibiting the effect of phosphatase activity.

Then, we conducted PRMC-MS measurements using spermatids and testicular spermatozoa, which are at the earlier maturation stages (Fig. 1c, d and Supplementary Fig. 5 and 6 , with cauda epididymis data included for comparison, as previously reported 8 , in Fig. 1f ). As shown in total PI(4)P/PI(4,5)P 2 ratio results (Fig. 1c–f ), the differences in the ratios between VSP +/- and VSP -/- gradually increase over this long-term maturation period. Furthermore, while spermatids exhibited no difference in total PI(4)P/PI(4,5)P 2 ratio between the genotypes, a significant difference was noted in LC-PUFA-containing variants (40:5 and 40:6) (Supplementary Fig. 6a , right ). Similarly, both in testicular spermatozoa and caput epididymal spermatozoa, a marked difference was evident for LC-PUFA-containing variants (e.g., 38:5, 38:6, 40:5, and 40:6) (Supplementary Fig. 6b, c , right ), with these distinctions diminishing in cauda epididymis (Supplementary Fig. 6d , right ). These results appear to suggest that mVSP may exhibit a preference for LC-PUFA during maturation, although the difference appears to be less obvious at the maturation stage, when the phosphatase activity is saturated.

mVSP activation occurs within the physiological voltage range of immature spermatozoa

Given that VSP demonstrates phosphatase activity during maturation, it is conceivable that the membrane potential of immature spermatozoa plays a crucial role in driving mVSP activity throughout its maturation process. We assessed the membrane potential of immature WT spermatozoa using the perforated patch clamp technique, preserving the intracellular environment. We observed that the averaged membrane potential of spermatozoa was −9.79 ± 1.23 mV ( n = 15), consistently exceeding −30 mV in all recordings (Fig. 2a ). Subsequently, we sought to determine if mVSP could be activated within this range of sperm membrane potential. Considering its structural resemblance to other VSPs (Fig. 2b ), mVSP is anticipated to possess normal voltage sensitivity. However, as mentioned in the introduction, there are no successful reports demonstrating the voltage-dependent enzymatic activity of mammalian VSPs in vitro. This problem likely stemmed from the accumulation of mammalian VSPs in the Golgi apparatus of expression system cells, preventing their transportation to the plasma membrane 20 . Previous studies suggest that the N-terminal domains and intracellular loops of transmembrane proteins play crucial roles in trafficking to the plasma membrane 21 , 22 , 23 , 24 , 25 . Furthermore, while mVSP and Ci-VSP have an overall similar structure and conserved sequences, their sequences differ in the N-terminus and intracellular loops (Supplementary Fig. 7 ; full length: identity = 41.5%, similarity = 61.4%; N-terminus: identity = 18.9%, similarity = 40.0%). We addressed this by modifying mVSP, replacing the N-terminus and the intracellular S2-S3 loop with those of Ci-VSP, while preserving functionally critical regions: VSD, VSD-PD linker, and PD (Fig. 2c, d ). This modification significantly enhanced the surface expression of mVSP in Xenopus oocytes (Fig. 2e, f ). Here we refer to this molecule as mVSP*.

a Recording of the resting membrane potential from immature spermatozoa. n = 15 cells examined over 7 independent mice. Data are represented as mean ± s.e.m. b The structural comparison of VSD between mVSP (light blue) and Ci-VSP (orange). The VSD structure of mVSP was predicted with ColabFold, an opensource software for protein structure prediction 54 . The VSD of Ci-VSP was solved in the previous study 26 . Some important residues are shown with the numbering of mVSP amino acids residues. c Schematic diagram of the modified mVSP (mVSP*). The voltage-sensing domain, linker region for electrochemical coupling, and phosphatase domain remained intact. The sequence alignment of the VSD between mVSP and Ci-VSP is also presented with amino acids from the experiment shaded in blue and orange, respectively. d The structure of the mVSP* was predicted with AlphaFold2. mVSP and Ci-VSP regions are shown in cyan and orange, respectively. The N terminus region is omitted. e , f Immunoblots against the surface proteins and total protein were detected by HA-antibody. The signals ( e ) and statistics ( f ) are shown. (* p < 0.05, unpaired two-sided t-test). N = 5 independent samples in ( f ). Data are represented as mean ± s.e.m. The exact p -value is shown in the Data Source file. g Voltage-dependent regulation of KCNQ2/3 activities by mVSP*. KCNQ2/3 was co-expressed with either the original mVSP, mVSP* WT or mVSP* C458S, an enzyme dead mutant. A +50 mV depolarization pulse was applied to activate both the VSPs and KCNQ2/3. The holding potential is −60mV. In mVSP* WT, the KCNQ2/3 current gradually decreased. In contrast, the current decrease was not observed in KCNQ2/3 co-expressed with either the mVSP or mVSP* C458S. h Statistical analysis for percent reduction of KCNQ2/3 currents. There was significant difference between WT and C458S (Tukey’s multiple comparison test. p -value is adjusted for multiple comparison. *** p < 0.001, **** p < 0.0001). N = 7, 8 and 8 independent experiments for mVSP, mVSP* and mVSP* C458S, respectively. Data are represented as mean ± s.e.m. The exact p -value is shown in the Data Source file. Voltage-dependency of mVSP* was analyzed using GIRK current. i Representative traces and the time course of GIRK current amplitudes with repetitive mVSP* activation. 1 s depolarization pulses (to activate mVSP*) were applied 21 times in the intervals of test pulses (−120mV, 100 ms). The red trace indicates the 21st trace. j Time course of the percent current reduction across repeated pulses. N = 11 independent experiments. Data are represented as mean ± s.e.m. k The voltage-dependency of mVSP* was estimated from the percent current reduction at the 21st pulse in ( j ). N = 11 and 3 independent experiments for mVSP* and mVSP* C458S, respectively. Data are represented as mean ± s.e.m.

We then evaluated the voltage-dependent phosphatase activity of mVSP* using KCNQ2/3 channels as a readout for PI(4,5)P 2 levels (Fig. 2g, h ). A notable decrease in KCNQ2/3 current occurred with prolonged depolarization-induced mVSP* activation, a phenomenon absents in non-modified original mVSP or enzyme-inactive mVSP* (mVSP* C458S), confirming its reliance on phosphatase activity. The voltage-dependency of mVSP* was further analyzed using GIRK (G protein-gated inwardly rectifying potassium channels) channels, applying repetitive 1-second voltage pulses with varying potentials (Fig. 2i ). The threshold for mVSP* activation was approximately −30 mV, and the activity gradually increased up to +50 mV, which was the upper limit of the repetitive 1-second long-pulse protocol, due to contamination from endogenous currents. Notably, the change in GIRK current amplitude was not observed in C458S. These results unequivocally demonstrate that mVSP can be activated above −30mV, a range within the physiological membrane potential of immature spermatozoa.

Detailed analysis of the voltage dependency of mVSP and its mutants

Given the upper limitation of +50 mV for the analysis with GIRK channels, an alternative technique was employed to scrutinize the detailed voltage-dependent properties of mVSP. We utilized PLCδ1-PH-GFP, a well-established PI(4,5)P 2 probe (Fig. 3a ), holding the membrane potential at −80 mV and applying a 10 s pulse protocol with different voltages up to +125 mV to examine the fluorescence change at the plasma membrane. Consistent with GIRK measurements, mVSP* activity was observed to begin around −30mV, reaching its maximum around +100 mV (Fig. 3b ).

a Schematic illustration of VCF experiments. b Left , Representative traces of fluorescence changes in mVSP*. 10 s pulses with different voltages were applied to observe fluorescence changes. The traces at various voltages are shown with different colors: black, cyan, blue, green, and red; to represent −50 mV, −25 mV, 0 mV, +50 mV and +100 mV, respectively. Right , The voltage-dependent activity of mVSP* WT as examined by fluorescence change. N = 10 independent experiments. Data are represented as mean ± s.e.m. c Schematic diagram showing the mutated residues targeted in the VCF experiment. Representative traces of fluorescence changes in mVSP* mutants. d Effect of mutations on VSD. D225R, R309Q and V312R were examined based on previous studies. N = 5, 6 and 7 independent experiments for D225R, R309Q and V312R, respectively. Because V312R showed significant difference from WT at −25 mV, it is also shown in the separate bar graph (Unpaired two-sided t-test, **** p < 0.0001). Data are represented as mean ± s.e.m. The exact p -value is shown in the Data Source file. e Effect of VSD-PD linker mutation. K347Q did not show any fluorescence change. N = 5. f Effect of PD mutation. C458S did not show any fluorescence change. N = 4 independent experiments. Data are represented as mean ± s.e.m. Surface protein expression of mVSP and its mutants ( g , K347Q and D225R; h , V312R and C458S; i , R309Q) in Xenopus oocytes. Images (i) and statistics (ii) are shown. Unpaired two-sided t-test or Dunnett’s multiple comparisons were performed for comparison with WT, but there was no significant difference. N = 5 independent samples in ( e ) and ( f ), while n = 6 independent samples in ( g ). Data are represented as mean ± s.e.m. The exact p -value with adjustment for multiple comparison is shown in the Data Source file.

Subsequently, point mutation experiments were conducted (Fig. 3c ), based on the reported mutations in other species of VSPs to elucidate the similarities and differences of mVSP with its counterparts. We initially examined the effect of mutation on VSD (Fig. 3c and d ). The mutation on D225 in S1, considered a countercharge for Arg in S4 and essential for voltage-sensing capability 26 , was examined. In alignment with previous studies 27 , 28 , mVSP* D225R exhibited voltage insensitivity within the physiological range of membrane potential. Next, two distinct point mutations in S4, essential for the voltage sensing of voltage-sensor proteins, were induced: R309Q, generally demonstrating a large leftward shifted voltage dependency in diverse VSPs 11 , 14 , 29 , 30 , 31 , 32 , 33 , and V312R, exhibiting a moderate leftward shift in VSD activity of Dr-VSP (T156R) 11 . Unexpectedly, R309Q did not impact the voltage sensitivity of mVSP*, contrary to previous reports on other VSPs. On the other hand, V312R moderately but significantly changed the voltage dependency of mVSP* leftward at a lower voltage (Fig. 3c, d ), which is partly consistent with the observation in Dr-VSP 11 . These PLCδ1-PH-GFP results were corroborated in GIRK experiments (Supplementary Fig. 8 ), although differentiating between WT and V312R was challenging due to the limited information above +50 mV in GIRK recording. Additionally, a K347Q mutation in the VSD-PD linker region, critical for functional coupling 34 , abolished voltage-dependent phosphatase activity (Fig. 3c–e ). Furthermore, C458S, an enzyme dead mutant, displayed no VSP activity (Fig. 3c, f ). We also confirmed that surface expression of mVSP* mutants remained unchanged (Fig. 3g–i ).

In summary, these findings suggest that the fundamental mechanisms of voltage sensing and electrochemical coupling in non-mammalian VSPs are largely conserved in mVSP, with subtle differences in the voltage-sensing machinery involving R309 of S4 when compared to other VSPs.

The mVSP V312R mutation affects sperm function

Our findings suggest that mVSP undergoes activation driven by the membrane potential of spermatozoa throughout the entire maturation process. To explore the voltage-sensing capability of endogenous mVSP in sperm flagellum, we generated three distinct knock-in mouse models featuring the V312R (moderately altered voltage sensitivity; Supplementary Fig. 9a ), D225R (voltage-insensitive; Supplementary Fig. 9b ), and K347Q (no VSD-PD coupling; Supplementary Fig. 9c ) mutations, based on observations from in vitro experiments (Fig. 3 ). Functionally inert VSP mutants (D225R and K347Q) did not exhibit any VSP expression in spermatozoa (Fig. 4b ), implying that a certain level of VSP activation is necessary for maintaining its expression in spermatozoa. Conversely, the quantity of endogenous VSP protein in spermatozoa of homogenous VSP V312R mice was comparable to that of wild-type VSP (Fig. 4b ).

a Schematic diagram shows the mutated residues targeted in the knock-in mouse experiment. b Western blotting results show the protein expression of mVSP and Basigin (positive control) in native spermatozoa of WT ( Vsp WT/WT ), Vsp KO, V312R mutants ( Vsp VR/VR ), D225R mutants ( Vsp DR/DR ) and K347Q mutants ( Vsp KQ/KQ ). In Vsp DR/DR and Vsp KQ/KQ , the mVSP signal disappeared as well as Vsp KO. Unpaired two-sided t-tests were performed between the WT and homozygous mutants. ** p < 0.01. For V312R, n = 4, 5 and 1 independent mice for Vsp WT/WT , V312R mutants ( Vsp VR/VR ), and Vsp KO, respectively. For D225R, n = 3 independent mice for each genotype. For K347Q, n = 3 independent mice for each genotype. Data are represented as mean ± s.e.m. The exact p -value is shown in the Data Source file. c , d Analysis of sperm motility before ( c ) and after ( d ) capacitation in WT and Vsp VR/VR . Left , Trajectories of spermatozoa isolated from WT and Vsp VR/VR mice. Spermatozoa were incubated for only 10 min in TYH in ( c ), while 2 h in ( d ). Right , Statistical analysis was performed on the percentage of cells showing circular motion using unpaired two-sided t -test (* p < 0.05). N = 5 independent mice for all experiment groups. Data are represented as mean ± s.e.m. The exact p -value is shown in the Data Source file. e Illustration of the parameters in sperm motility analysis. f , g Quantitation of sperm motility parameters of non-capacitated ( f ) and capacitated ( g ) spermatozoa. The individual parameters are described in ( e ). Unpaired two-sided t -test * p < 0.05. N = 5 independent mice for all experiment groups. Data are represented as mean ± s.e.m. The exact p -value is shown in the Data Source file.

In a previous study, we found that VSP deficiency leads to abnormal sperm motility only after capacitation 8 . Therefore, we assessed the impact of the V312R mutation on sperm motility both before and after capacitation. We did not observe any differences in motility pattern between the wild-type and V312R homo spermatozoa before capacitation (Fig. 4c ). On the other hand, a substantial proportion of VSP V312R spermatozoa showed circular motion after capacitation which is significantly higher than wild-type littermates (Fig. 4d ). We also analyzed velocity using different parameters in detail (Fig. 4e ). Similarly, Vsp VR/VR spermatozoa exhibited a slight but significant difference in VCL (curvilinear velocity) and ALH (amplitude of lateral head) compared to Vsp WT/WT only after capacitation (Fig. 4g ), but not before capacitation (Fig. 4f ).

We also analyzed the PIPs profile in both immature and mature spermatozoa from the caput and cauda epididymis of Vsp WT/WT and Vsp VR/VR mice. Once again, the PI(4)P/PI(4,5)P 2 ratio progressively increased during sperm maturation in both Vsp WT/WT and Vsp VR/VR (Fig. 5a, b ). The total PI(4)P/PI(4,5)P 2 ratio remained nearly identical between Vsp WT/WT and Vsp VR/VR in both the caput and cauda epididymis (Fig. 5b ). However, LC-PUFA containing groups, especially 40:6, exhibited a trend of increase in Vsp VR/VR for both the caput and cauda epididymis (Fig. 5c–g ). In summary, the VSP V312R mutation, characterized by a leftward shift in voltage sensitivity, appears to exert a moderate but significant effect on spermatozoa function, underscoring the importance of the membrane potential in VSP function.

a Schematic diagram showing the V312R mutation residue and different maturation stages of spermatozoa. b Total PI(4)P/PI(4,5)P 2 analysis of spermatozoa in caput and cauda epididymis from WT ( Vsp WT/WT ) and V312R mutants ( Vsp VR/VR ). There was no difference between the two genotypes, although the PI(4)P/PI(4,5)P 2 ratio significantly increased during maturation in both genotypes. (Tukey’s multiple comparison test. p -value is adjusted for multiple comparison. **** p < 0.0001, n = 10 for each group). N = 10 independent mice for each genotype. Data are represented as mean ± s.e.m. The exact p -value is shown in the Data Source file. c , d PI(4)P/PI(4,5)P 2 ratio profiles are identified based on sn-1 and sn-2 acyl chains in Vsp WT/WT and Vsp VR/VR spermatozoa from caput ( c ) and cauda ( d ) epididymis. n.a. indicates that the calculation cannot be performed due to no PI(4,5)P 2 detection. N = 10 independent mice for each genotype, but the outlier is removed as appropriate. See also Source Data file. Data are represented as mean ± s.e.m. e Two-sided multiple-t test with no adjustments for multiple comparisons is performed and the p -value is shown in the table. The increases or decreases in Vsp VR/VR with a p -value < 0.05 were highlighted in red and blue, respectively. f , g The comparison of for (40:6) acyl chain in caput and cauda epididymis. (two-sided t-test., * p < 0.05 and ** p < 0.01, respectively. N = 10 independent mice for each genotype. Data are represented as mean ± s.e.m. The exact p -value is shown in the Data Source file.

In this study, we have elucidated that VSP undergoes activation throughout sperm maturation, suggesting that the membrane potential of immature spermatozoa plays a crucial role in shaping the appropriate PIPs environment within the sperm flagellum (Fig. 6 ). This research marks the successful observation of the voltage-dependent enzymatic activity of mammalian VSPs in vitro, revealing that mVSP can be activated at the resting membrane potential of immature spermatozoa. Lastly, we discovered that the VSP mutant (V312R) with moderately shifted voltage-range-of-activation showed altered pattern of sperm motility and altered PIPs profile, further highlighting the importance of electric signal in maturing spermatozoa for VSP activation.

a mVSP activation during sperm maturation. Proper PI(4,5)P 2 environment of sperm flagellum, which is important for sperm function, is gradually formed during this process. b Voltage-dependency of mVSP in spermatozoa. We hypothesize that both V312R and WT are activated with resting membrane potential of maturing spermatozoa. D225R and K347Q shows protein degradation, because the basal phosphatase activity is required for VSP expression in spermatozoa.

Spermatozoa undergo dynamic lipid remodeling during epididymal maturation 35 . Here, we report that the PIPs profile is altered during sperm maturation, with Long-Chain Polyunsaturated Fatty Acids (LC-PUFA) preferentially incorporated into PIPs as spermatozoa undergo maturation. Furthermore, we identify VSP as a key player in this process, indicating that VSP is partly responsible for the lipid remodeling in terms of PIPs composition.

Considering that the PIPs level is generally balanced between phosphoinositide phosphatase and kinase activities, it is crucial to evaluate the contribution of kinases to this process. A previous study investigated the expression of phosphatidylinositol 4-phosphate 5-kinase (PIP5K) in spermatogenesis 36 . They reported that the expression of PIP5K isozymes (PIP5K1A and PIP5K1B) is highest in elongated spermatids but significantly reduced in epididymal spermatozoa. Consistent with this finding, our study reveals a gradual decrease in the PI(4)P/PI(4,5)P 2 ratio from spermatids to immature spermatozoa in VSP-deficient spermatozoa. However, this ratio does not undergo substantial changes in spermatozoa from the caput to cauda epididymis (Fig. 1b ). Overall, it is likely that PIP5K activity is relatively low in epididymal spermatozoa, with VSP emerging as the major regulator of PI(4,5)P 2 levels during epididymal maturation.

Notably, VSP exhibits a preference for targeting LC-PUFA during specific maturation stages (Supplementary Fig. 6 ). While the detailed molecular mechanism remains elusive, LC-PUFA, a newly incorporated lipid during maturation, maybe a susceptible target for VSP. Alternatively, our prior research unveiled that VSP establishes a heterogeneous distribution of PI(4,5)P 2 in the sperm flagellum 8 , which raises the possibility that LC-PUFA may also display heterogeneous distribution in the sperm flagellum, facilitating easy access for VSP to these molecules.

In this study, we demonstrated the voltage-sensing phosphatase activity of mammalian VSP using a heterologous expression system. Previous studies only reported the functionality of the PD of mammalian VSP by generating chimeras in which the enzyme domain was replaced from Ci-VSP to mammalian VSPs 12 , 15 , 37 . However, VSP requires other several factors such as VSD motion and VSD-PD coupling, in addition to enzyme activity, for proper function 3 . Therefore, it had been crucial to confirm the activity with the entire mammalian VSP structure. The present modified mVSP (mVSP*), retaining the intact VSD, VSD-PD linker, and PD, exhibited normal voltage-sensing phosphatase activity, strongly supporting the role of mVSP as a voltage-sensing phosphatase.

In heterologous expression experiments, mVSP* displayed phosphatase activity above −30mV. This threshold is comparable to that reported for Ci-VSP 2 , 3 and even more negative than other VSPs such as those from zebrafish, chicken, and frogs 3 , 11 , 12 , 13 , 14 . Additionally, mVSP* showed conservation of the common activation machinery shared with other non-mammalian VSPs. For instance, the mutation of D225 residue in S1 which is supposed to form a salt-bridge with Arg in S4 3 , 26 , 38 , completely abolished voltage-sensitivity consistent with the previous findings in Ci-VSD 27 . Furthermore, V312R mutation showed a moderate change in the voltage dependency, which is partially also consistent with the previous studies in Dr-VSP 11 . Similarly, the mutation K347Q in the VSD-PD linker of mVSP*, akin to other non-mammalian VSP 34 , demonstrated a common coupling mechanism between VSD and PD. Unexpectedly, the R309Q mutation in mVSP*, corresponding to R217Q in Ci-VSP, did not significantly alter voltage-sensitivity, contrary to previous reports for other VSPs 11 , 14 , 29 , 30 , 31 , 32 , 33 . This difference appears to suggest that the extracellular space of S4 in mVSP may have a distinct surface charge environment from other VSPs.

It is important to note that we modified the N-terminal and S2-S3 loop of mVSP for efficient expression in Xenopus oocytes. While this manipulation may potentially affect voltage-sensitivity, our previous study demonstrated that similar modifications of the N-terminal did not change the voltage-dependency of other VSPs or ion channels in Xenopus oocytes 21 , 22 . Also considering the lack of evidence that the intracellular S2-S3 loop critically regulates voltage-sensing phosphatase activity, despite comprehensive biophysical analyses of VSP 3 , it is unlikely that modifications to the N-terminal or S2-S3 loop of mVSP confer voltage sensitivity.

Our study suggests that VSP undergoes activation during epididymal maturation, a crucial process for establishing proper PIPs environments in matured spermatozoa. Therefore, we aim to discuss the voltage-sensing mechanism of VSP during this maturation process. Our heterologous expression experiments indicate that VSP becomes activated above −30 mV, a membrane potential range observed in immature spermatozoa. It is important to consider the possibility that the less negative membrane potential of immature spermatozoa could be also due to an incomplete pipette seal during the recording. However, when performing voltage-clamp experiments on the same measurements, we observed clear voltage-dependent currents (Supplementary Fig. 11a ), indicating that the quality of our measurements is reliable. Furthermore, alkalinizing the intracellular pH evoked a large hyperpolarization response in the same recording, which is consistent with previous papers (Supplementary Fig. 11b ) 9 . Therefore, it appears that the influence of leakage on our measurements of membrane potential is limited.

Notably, the several studies report that ion composition of the mammalian epididymal lumen significantly differs from the experimental HEPES-based solutions 39 , 40 , 41 , 42 . For instance, the rat cauda epididymis is reported to contain approximately 55 mM K + and only 20 mM Na + , potentially leading to a more depolarized state of spermatozoa compared to experimental conditions. Therefore, it is possible that extent of VSP activity in experimental condition was underestimated and VSP may be more efficiently activated at the resting membrane potential of epididymal spermatozoa.

Unexpectedly, single mutations in D225 (to R, causing voltage insensitivity) or K347 (to Q, resulting in no electrochemical coupling) eliminated VSP expression in spermatozoa (Fig. 4b ), although these mutants showed normal surface expression in heterologous expression systems. This implies that the basal phosphatase activity is essential for maintaining VSP expression in spermatozoa, and it is also consistent with our previous finding that functionally inactive Venus-tagged VSP lacked protein expression itself in spermatozoa 8 . Building on this idea, the observation that voltage-insensitive mutants (D225R) do not exhibit VSP expression appears to suggest that voltage sensing is crucial for VSP activity in spermatozoa.

Besides, V312R, which has leftward shift of voltage range for activation, showed modifications in PIPs profiles as well as sperm motility in the present study. Notably, the V312R mutant showed a differential trend in the LC-PUFA-containing PI(4,5)P 2 variant, possibly related to the observation that VSP selectively targets LC-PUFA at certain maturation stages (Supplementary Fig. 6 ). In the motility analysis, V312R exhibited the phenotype only after capacitation. This result is important because the sperm motility was significantly changed only after capacitation in VSP-deficient spermatozoa in the previous study 8 .

Previously, we observed that PI(4,5)P 2 levels are elevated in VSP-deficient spermatozoa, which enhances SLO3 activity and influences Ca 2+ signaling during capacitation 8 . It is also possible that some other regulatory mechanism by PI(4,5)P 2 is important for the capacitation, because the V312R spermatozoa only showed the partial increase in PI(4,5)P 2 levels in some acyl groups. For example, our previous study demonstrated that PI(4,5)P 2 is heterogeneously distributed along the sperm flagella with some clusters 8 , potentially affecting the localization of membrane proteins within the flagellum. Therefore, the altered PI(4,5)P 2 distribution might affect the protein localization that is important for capacitation. Interestingly, we observed that the expression of VSP itself is absent in mutants with severely impaired VSP function (D225R and K347Q). This result implies that the quantity of PI(4,5)P 2 potentially affect the expression of transmembrane proteins, including VSPs. It would be interesting, if VSP changes the expression profile of transmembrane proteins that are important for capacitation.

In conclusion, our results provide evidence for the critical role of voltage-sensing property of mVSP in spermatozoa. Future investigations into the regulatory mechanisms of membrane potential in maturing spermatids or spermatozoa will further enhance our understanding of the intricate relationship between membrane potential and enzyme activity.

In most experiments involving VSP-deficient animals, we utilized the same lineage as in our prior publication 8 . This lineage comprises VSP knock-in mice, where the PD was truncated at the active catalytic center, and Venus was fused at the end. Unexpectedly, this lineage lacked VSP protein in mature spermatozoa. Additionally, another VSP-deficient animal was generated to assess VSP protein expression in both immature and mature spermatozoa (See also Supplementary Fig. 3 ). All animal procedures were approved by the Animal Care and Use Committees of Osaka University.

Generation of another VSP-deficient mice

The pX330 plasmids expressing humanized Cas9 and single guide RNAs targeting exon 4 were injected into pronuclei of zygotes of B6D2F1 x B6D2F1 mice 43 , 44 . The sequence of gRNA is 5’-AGGTGTCAGTGAGTGCTTCA-3’. Embryos were cultured in KSOM overnight and subsequently transferred into the oviducts of pseudopregnant Institute of Cancer Research (ICR) outbred female mice. Screening of mutant pups was performed by direct sequencing following polymerase chain reaction (PCR) using primers (5’-ACCTGAAGCCATAGCTTAAGC-3’ and 5’-TTCTCCCACACTGGCTGGCTCAAG–3’). A founder mouse with an 1 bp insertion was used to expand the colony. The animal was backcrossed with C57BL/6 mice for three times. We confirmed that VSP protein expression is abolished in the homozygous mutant animals (Supplementary Fig. 3 ).

Plasmid and RNA Synthesis

mVSP was subcloned from mouse testis cDNA into the pSD64TF vector for cRNA synthesis. Hemagglutinin (HA)-tag sequence was introduced at the C-terminal of mVSP for detection in Western blotting. As illustrated in Fig. 2 , we replaced the N-terminal of mVSP (M1-S211) with that of Ci-VSP (M1-H115) and the S2-S3 loop of mVSP (V265-D276) with that of Ci-VSP (I169-N180) to design mVSP*. The nucleotide sequence of mVSP* is also shown in Supplementary Fig. 12 (see also Supplementary Table 1 for the primers). The number of amino acid residues in mVSP* (e.g., V312) is assigned with reference to the native mVSP. The GIRK2d (Kir3.2d) plasmid was provided by Dr. Yoshihisa Kurachi (Osaka University, Japan) 45 . G-protein β1 and γ1 subunit plasmids were provided by Dr. Toshihide Nukada (retired). KCNQ2/3 plasmids were provided by Dr. David McKinnon (Stony Brook University) and Dr. Koichi Nakajo (Jichi Medical University, Japan). Mutagenesis was performed using Primestar Max (Takara, Japan; see also Supplementary Table 1 for the primers). cRNA was synthesized using the mMESSAGE mMACHINE transcription kit (Thermo Fisher Scientific) after linearization with restriction enzymes.

Recordings of membrane potentials from immature spermatozoa

We performed perforated patch clamp recordings from immature spermatozoa to measure membrane potentials 8 , 46 . Sperm were isolated from the corpus epididymis in an HS-based solution containing (in mM): 135 NaCl, 5 KCl, 2 CaCl 2 , 1 MgSO 4 , 20 HEPES, 5 glucose, 10 lactic acid and 1 sodium pyruvate (pH 7.4). After 10 min, the supernatant was centrifuged, washed twice, resuspended in the HS-based solution, and placed on untreated glass coverslips. After 10 min, the coverslips were transferred to the recording chamber which was perfused with the HS-based solution. Recording pipettes were made of borosilicate glass (BF-150-86-10; Sutter Instruments, CA, USA) using a puller (P-97; Sutter Instruments). The intracellular solution contained (mM): 120 KCl, 3 MgCl 2 , 40 HEPES, 0.3 EGTA (pH 7.0), and 0.05 mg/ml gramicidin. We applied the negative pressure from the pipette to the cytoplasmic droplet of the spermatozoa to form the tight giga-ohm seal. After the giga-ohm seal, we waited for the pore formation by antibiotics which could be monitored by the access resistance. After pore formation, the access resistance was 50–100 MΩ. Recordings were performed using an Axopatch 200B (Molecular Devices, CA, USA) and sampled at 5 kHz using Digidata 1550 A (Molecular Devices) and pCLAMP 10.5 software (Molecular Devices).

Two-electrode voltage clamp recordings in oocytes

Xenopus oocytes were harvested from animals anesthetized in water containing 0.2% ethyl 3-aminobenzoate methanesulfonate salt (Sigma-Aldrich, St. Louis, MO). The oocytes were defolliculated by treating with type I collagenase (1.0 mg/mL; Sigma-Aldrich) in ND96 solution containing (in mM): 96 NaCl, 2 KCl, 5 HEPES, 1.8 CaCl 2 , and 1 MgCl 2 (pH 7.5). The defolliculated oocytes were then injected with cRNA. Current recordings were conducted two days after cRNA injection by two-electrode voltage clamp (TEVC) using an amplifier (OC-725; Warner Instruments, Hamden, CT). Acquired data were digitized using an AD/DA converter Digidata 1440 A running under pClamp at room temperature (22–24 °C). Output signals were digitized at 10 kHz. The bath solution was ND96, the glass electrodes were filled with 3 M KCl, and the resistances ranged from 0.2–1.0 MΩ. The holding potential was −60 mV.

Commercially obtained antibodies include goat polyclonal anti-BASIGIN (sc-9757, Santa Cruz, Santa Cruz, CA, USA), mouse monoclonal anti-β-Tubulin IV (T7941, Sigma-Aldrich), anti-HA (MMS-101R, Covance, Berkeley, CA, USA), Alexa Fluor 488-conjugated chicken anti-rat IgG (A-21470, Invitrogen, Carlsbad, CA, USA), Alexa Fluor 594-conjugated goat anti-mouse IgG (A-11005, Invitrogen), HRP-linked anti-rabbit or mouse secondary antibodies (NA9340V or NA9310V; GE Healthcare, Pittsburgh, PA, USA), and HRP-linked anti-goat secondary antibody (sc-2354; Santa Cruz Biotechnology). The VSP antibody used was the same as in our previous study 8 . The rat monoclonal anti-IZUMO1 antibody was generated previously 47 .

Isolation of Different Stages of Spermatids and Spermatozoa for PIPs Measurement

Mature and immature spermatozoa were isolated from cauda and caput epididymis, respectively. After making an incision in the epididymis, the tissues were stirred in an HS-based solution. After counting the cells, the sperm were centrifuged at 500 g for 5 min at 4 °C. The pellets were washed with PBS and centrifuged again at 500 g for 5 min at 4 °C. The pellets were then frozen and used for analysis.

For isolation of testicular spermatozoa and spermatids, we modified a previously reported two-step enzymatic digestion method 48 . Seminiferous tubules were dissociated with collagenase type I (1.0 mg/mL; Sigma-Aldrich) for 25 min at 32 °C in incubation medium; Hanks’ balanced salt solution (HBSS) supplemented with 20 mM HEPES (pH 7.2), 1.2 mM MgSO 4 , 1.3 mM CaCl 2 , 6.6 mM sodium pyruvate, and 0.05% lactate. Tubules were collected, and after a filtration step with a 40-µm nylon mesh, tubules were retained in the filter. The tubules were collected again and incubated at 32 °C for 25 min in the same collagenase buffer. The resulting whole cell suspension was filtered through a 40-µm nylon mesh to remove cell clumps. For testicular spermatozoa, the suspension was centrifuged at 300 g for 5 min at 4 °C and supernatant was collected. The sediment was used for spermatids collection as described later. The supernatant fraction was centrifuged with 800 g for 5 min at 4 °C, and then the supernatant was removed. After adding 1 mL incubation medium, it was centrifuged again at 800 g for 5 min at 4 °C. The pellet contained high purity of testicular spermatozoa (Supplementary Fig. 5b ). For isolation of spermatids, we used the above-mentioned sediment for flow cytometry and cell sorting as previously reported 48 , 49 . The cells were stained with Hoechst 33258 (5 µg/million cells; Dojindo, Kumamoto, Japan) for more than 30 min at room temperature. BD FACSAria IIIu was used for flow cytometry and cell sorting. Hoechst was excited using a 375 nm laser, and the dye’s wide emission spectrum detected in two distinct channels: “Hoechst Blue” (450/20 nm band-pass filter) and “Hoechst Red” (670 nm long pass filter). Forward Scatter (FSC-A) and Side Scatter (SSC-A) were detected using a 488 nm laser. The fraction of spermatids was collected in incubation medium (Supplementary Fig. 5a ) and centrifuged at 8000 g for 5 min at 4 °C. The cells were obtained from the pellet.

PIPs sample preparation

Mass spectrometric analyses of PIPs was performed as previously reported 19 . Frozen sperm samples were thawed and suspended in 1.5 mL of methanol. To this suspension, 50 µL of a methanol/chloroform (9/1) solution containing 1 nmol of C8:0/C8:0 PI(4,5)P 2 (serving as an absorption inhibitor) and 10 pmol each of synthetic C17:0/C20:4 phosphoinositide as internal standards were added. This mixture was then combined with 750 µL of ultrapure water, 750 µL of 2 M HCl, and 200 µL of 1 M NaCl. Following a thorough vortex-mixing, 3 mL of chloroform was added, and the mixture was vortexed again for 2 min. The resulting solution was centrifuged at 1200 g for 4 min at room temperature. The lower organic phase, which contains the crude lipid extract, was carefully collected and transferred into a fresh glass tube. PIPs were preconcentrated using an anion exchanging resin. DEAE Sepharose Fast Flow (10% slurry) was sequentially rinsed: twice with an equal volume of ultrapure water, once with 1 M HCl, twice again with ultrapure water, once with 1 M NaOH, and then twice with ultrapure water. The resin was then resuspended in methanol to create a 50% slurry, and a 0.5 mL bed volume was packed into a Pasteur pipette plugged with glass wool. The crude lipid extract (2.9 mL) was mixed with 1.5 mL methanol and applied to the column. The column was washed with 3 mL of a chloroform/methanol (1/1) solution, followed by 2 mL of a chloroform/methanol/28% aqueous ammonia/glacial acetic acid (200/100/3/0.9) solution. Elution was performed using 1.5 mL of chloroform/methanol/12 M hydrochloric acid/ultrapure water (12/12/1/1). The eluate was then mixed with 850 µL of 120 mM NaCl and centrifuged at 1200 g for 4 min at room temperature. The lower phase, containing purified PIPs, was collected into a fresh glass tube. The purified PIPs were derivatized through methylation, following the method of Clark et al 50 . Briefly, 150 µL of 0.6 M trimethylsilyl diazomethane was added to the purified phosphoinositide fraction prepared as described above at room temperature. After 10 min, the reaction was stopped by adding 20 µL of glacial acetic acid. The samples were then mixed with 700 µL of a methanol/ultrapure water/chloroform (48/47/3) solution, followed by 1 minute of vortexing. After centrifugation at 1200 g for 4 min, the lower phase was dried under a stream of nitrogen and redissolved in 100 µL of acetonitrile.

PI4P/PI(4,5)P 2 measurements by PRMC-MS

Phosphoinositide regioisomer measurement by chiral column chromatography and mass stepctrometery (PRMC-MS) was conducted using a QTRAP6500 triple quadrupole mass spectrometer (ABSciex) paired with a Nexera X2 HPLC system (Shimadzu) and a PAL HTC-xt (CTC Analytics) autosampler. Spectra were recorded in positive ion mode as [M + NH 4 ] + ions, with an MS/MS scan duration of 0.5 sec. The ion spray voltage was set to 5.5 kV, cone voltage to 30 V, and source block temperature to 100 °C. The curtain gas was set to 20 psi, collision gas to 9 psi, ion source gas pressures 1/2 to 50 psi, declustering potential to 100 V, entrance potential to 10 V, and collision cell exit potential to 12 V. Collision energy values for gas phase fragmentation are detailed in Supplementary Table 2 . A 10 µL lipid sample was injected using the autosampler, and lipids were separated using a CHIRALPAK IC-3 column (2.1 mmφ x 250 mm, 3 µm, DAICEL) in a 22 °C room. The liquid column chromatography was conducted at a flow rate of 100 µL/min with the following gradient: 40% mobile phase A (methanol/5 mM ammonium acetate) and 60% mobile phase B (acetonitrile/5 mM ammonium acetate) held for 1 minute, linearly increased to 85% mobile phase A over 2 min and maintained at 85% mobile phase A for 11 min. Data acquisition and processing were performed using Analyst 1.6.3 (SCIEX), while MultiQuant (SCIEX) was used for manual data evaluation and peak integration. No background subtraction was carried out, and Gaussian smoothing width was set to 1.0 points. For quality control, peaks from samples where the cps of the surrogate internal standards (SIS; C37:4 PIPs) from the multiple reaction monitoring (MRM) scan were below 2 × 10 4 were excluded from quantification analysis. The sample peak area value was divided by the corresponding SIS peak area value (equivalent to 1 pmol) to achieve relative quantification. Supplementary Table 3 lists the MRM transitions (pairs of m/z values of precursor ions and fragment/diacylglycerol ions) used for the identification and quantification of each PI4P/PI(4,5)P 2 molecular species.

Reverse phase (RP) LC-MS/MS analysis

An Ultimate 3000 LC system (Thermo Fisher Scientific) was used for the RP LC-MS/MS analysis, connected in tandem to a TSQ Vantage triple stage quadrupole mass spectrometer (Thermo Fisher Scientific) operating in positive-ion mode. The derivatized phospholipids (the injection volume was 20 μL, and the flow rate was set at 220 μL/min) were separated on an InertSustainBio C18 column (GL Sciences) with the following solvent gradient: 0–1 minute hold at 70% A/30% B, 1–3 min linear gradient to 90% A/10% B, 3–7.5 min constant at 90% A/10% B, and 7.5–13 min at 30% A/70% B. Here, mobile phase A consisted of acetonitrile/ ultrapure water/70% ethylamine (800:200:1.3), and mobile phase B consisted of isopropanol/acetonitrile/70% ethylamine (800:200:1.3). Measurement of PIP and PIP 2 species was achieved through MRM using a pre-set list of mass to charge ratio values (Supplementary Table 4 ). Spray voltage was set to 3250 V, sheath gas pressure to 15 arbitrary units, capillary temperature to 300 °C. Supplementary Table 5 lists the voltage for fragmentation. Data acquisition and processing and peak integration were performed using Xcalibur software 2.0 (Thermo Fisher Scientific). The quantification was achieved by dividing the sample peak area value by the corresponding the internal standard peak area value.

Western blotting from spermatozoa

Sperm were isolated from caput and cauda epididymis. They were rotated at 4 °C for 1 hour in a lysis solution containing: 10 mM Tris-HCl (pH 7.5), 50 mM KCl, 1% Triton X-100, and cOmplete™ Protease Inhibitor Cocktail (Roche). After centrifugation (9000 g for 5 min at 4 °C), the supernatant was mixed with sample buffer and 2.5% 2-ME. After SDS-PAGE, the proteins were transferred to a PVDF membrane. After blocking with 0.5% skim milk or 2% BSA, the blots were incubated with the primary antibody: anti-VSP (1:500) or anti-BASIGIN (1:500) in Can get signal 1 (Toyobo, Osaka, Japan). The membranes were washed and incubated with HRP-linked anti-rabbit or goat antibody (1:1000) in Can get signal 2 (TOYOBO). The signals were detected with ECL Prime Western Blotting Detection Reagent (GE Healthcare). Images were acquired using a CS analyzer system (ver. 3) (ATTO, Tokyo, Japan). Antibody stripping was sometimes performed using 200 mM Glycine (pH 2.8) for 10 min at 60 °C for other antibody experiments. The signal intensity of individual bands was calculated by subtracting the background intensity.

Western blotting of membrane proteins from Xenopus oocytes

Two days prior to the experiment, Xenopus oocytes were injected with cRNA. They were then placed in ND96 solution containing EZ-Link Sulfo-NHS-SS-Biotin (0.5 mg/mL, Thermo Fisher Scientific) for 30 min at room temperature. Cells were washed with PBS three times and quenched with lysed in 300 µL PBS supplemented with Triton X-100 (1%; Sigma Aldrich) and Complete protease inhibitor cocktail tablets without EDTA (Roche, Basel, Switzerland). After centrifugation (15310 g for 10 min at 4 °C), 150 µL of the supernatant was retained as “total lysate,” and the rest was incubated overnight at 4 °C under gentle rotation with 30 µL streptavidin agarose beads (COSMO BIO, Tokyo, Japan) pre-washed with PBS. The beads were collected by centrifugation (15310 g for 10 min at 4 °C) and washed with PBS containing 1% Triton X-100 three times. Biotinylated proteins were eluted from the streptavidin agarose beads by incubating in SDS-PAGE sample buffer containing 2.5% 2-ME for 30 min at room temperature (“Cell surface”). Total lysates were also mixed with SDS-PAGE sample buffer with 2.5% 2-ME. After SDS-PAGE for the supernatant, the proteins were transferred to a PVDF membrane. After blocking with 0.5% skim milk the blots were incubated with the primary antibody: anti-HA (1:2000, Covance, Berkeley, CA) in Can get signal 1 (Toyobo, Osaka, Japan). The membranes were washed and incubated with HRP-linked anti-mouse antibody (1:2000, Cytiva, Massachusetts, USA) in Can get signal 2 (TOYOBO). The signals were detected with ECL Prime Western Blotting Detection Reagent (GE Healthcare). Images were acquired using a CS analyzer system (ver. 3) (ATTO, Tokyo, Japan).

Sperm motility analysis

Sperm velocity was analyzed as described previously 51 . Spermatozoa isolated from the cauda epididymis were suspended in TYH medium, a well-established capacitation-inducing medium 52 . TYH contains: 120 mM NaCl, 4.8 mM KCl, 1.2 mM KH 2 PO 4 , 5.6 mM glucose, 1.0 mM sodium pyruvate, 1.7 mM CaCl 2 , 1.2 mM MgSO 4 , 25 mM NaHCO 3 , 4.0 g/L ALBMAX I (Thermo Fisher Scientific), penicillin (50 units/mL)-streptomycin (50 μg/mL), and 0.6% Phenol-red. Average path velocity (VAP), curvilinear velocity (VCL), straight-line velocity (VSL), and Amplitude of Lateral Head Displacement (ALH) were measured using the CEROS II sperm analysis system (Hamilton Thorne Biosciences, MA, USA) at 10 min and 2 h after incubation. Sperm motility was videotaped with an Olympus BX-53 microscope equipped with a high-speed camera (HAS-L1, Ditect, Tokyo, Japan) at 200 frames per second. The trajectory was visualized with 450 frames using ImageJ software (NIH) and plug-in Color Footprint Rainbow developed by Y. Hiratsuka (JAIST, Ishikawa, Japan).

Voltage Clamp Fluorometry (VCF) recording with PHPLCδ1-GFP

The plasmid of the GFP-fused pleckstrin homology domain from the PLCδ1 subunit (PHPLCδ1-GFP) was used as previously reported 53 . The microscope BX50WI upright fluorescence microscope (Olympus, Japan) was used with a 20 × 0.75 N.A. objective lens and LED lamp (MCWHL8: Thorlabs, Inc., New Jersey, USA), fitted with an excitation filter of BP460-480HQ (Olympus) and an emission filter of BA495-540HQ (Olympus). The emitted light is detected by a PMT (H10722-20; Hamamatsu Photonics, Japan). TEVC recording was done using the amplifier, Oocyte Clamp OC-725C (Warner Instruments, USA). Data were digitized using Digidata 1440A (Molecular Devices, USA) run by the software pClamp 10.3 (Molecular Devices, USA) with a 10 kHz sampling rate on Windows PC. After digitization, data were digitally filtered at a cut-off frequency of 50 Hz on pClamp. The bath solution was ND96, and the glass electrodes were filled with 3 M K + -acetate and 10 mM KCl. The resistances ranged from 0.2-1.0 MΩ. The holding potential was −80 mV. A depolarizing pulse (−50 to 125 mV) was applied for 10 s.

Generation of VSP point-mutation knock-in mice

In this study, we generated D225R, V312R, and K347Q mice. C57BL/6 fertilized eggs were obtained by in vitro fertilization. Oligonucleotides (200 ng/μl) and crRNA/tracrRNA/Cas9 ribonucleoproteins (40 ng/μl crRNA plus tracrRNA, 100 ng/μl CAS9) were electroporated into the fertilized eggs using a super electroporator NEPA21 (NEPA GENE, Chiba, Japan) (poring pulse, voltage: 225 V, pulse width: 2 ms, pulse interval: 50 ms, and number of pulses: +4; transfer pulse, voltage: 20 V, pulse width: 50 ms, pulse interval: 50 ms, and number of pulses: ±5). The reference oligonucleotides contained the point mutations D225R, V312R, and K347Q, respectively. Furthermore, it contains silent mutations that prevent recutting of the target sequences and allow recognition by the restriction enzyme for convenient genotyping (Fig. 4 and Supplementary Fig. 6 ). The reference oligonucleotides are listed in Supplementary Table 6 . One out of 25, 8 out of 24, and 5 out of 15 pups contained the expected mutations in D225R, V312R, and K347Q, respectively. The animals were crossed with C57BL/6 mice to expand the colony. The genotype primers for each knock-in mouse are as follows: D225R, 5′–GGGGCTTGGTGCATACTTTA–3′ and 5′–AGCTGTGACAAAGCCACTG–3′; V312R, 5′–CATTGCCCTTTGTCTTCTAC–3′ and 5′–ATTGGGAAATCATAAAGCTG–3′; K347Q, 5′–CCTTGTGTCTCGGGGAAATA–3′ and 5′–GCTCACGTGACTCAGGGAAT–3′.

Immunocytochemistry for isolated spermatid and testicular spermatozoa

The isolated spermatids or spermatozoa in incubating medium were seeded on 1 mg/mL poly-L-lysine coated coverslips. After 1 h, the sample was fixed with 4% PFA/PBS. Cells were washed with 0.3% PBST. For the primary antibody, a rat monoclonal anti-IZUMO1 (1:500 dilution) and anti-β-Tubulin IV (1:500 dilution) was used with 10 % goat serum. The binding of the primary antibody was detected using Alexa Fluor 488-conjugated chicken anti-rat IgG (1:2000 dilution) and Alexa Fluor 594-conjugated goat anti-moue IgG (1:2000 dilution). Confocal images were acquired using a LSM770 confocal laser scanning system (Carl Zeiss, Germany).

Litter size analysis

Male mice of each genotype were crossed with 8 − 11 weeks old of wild-type female mice. The number of pups was defined as litter size.

In vitro fertilization

Mature cumulus intact oocytes were collected from wildtype females and placed in a drop of 100 μl TYH medium. Spermatozoa were collected from cauda epididymis of male mouse and incubated in TYH medium for 2 h to induce capacitation. Capacitated spermatozoa were added to the TYH drop containing oocytes at a final concentration of 2 × 10 ^5 sperm/ml. Embryos reaching the two-cell stage by the next day were counted as fertilized.

Data Analysis

Data analysis was performed with Excel 2016 (Microsoft, USA), Clampfit 10.5 (Molecular Device, USA), and Igor Pro 6.37 (WaveMetrics, USA) software. Statistical analysis was performed with Prism 6 (GraphPad Software, San Diego, CA). For two-group comparison, we conducted an unpaired t-test or Mann-Whitney test as appropriate. An outlier was detected with Grubbs’ Test (α = 0.05) in individual experiment groups and removed from the analysis (Fig. 5c, d ). For multiple comparisons, we conducted multiple t -test, Dunnett’s multiple comparisons or Tukey’s test as appropriate. Data are represented as mean ± s.e.m. *, **, ***, and **** indicate a significant difference: p < 0.05, p < 0.01, p < 0.001, and p < 0.0001, respectively.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The data generated in this study are provided in the main text or the Supplemental materials. Source data are provided with this paper.

Hille B. Ion channels of excitable membranes . Sinauer Associates Inc, Sunderland (2001).

Murata, Y., Iwasaki, H., Sasaki, M., Inaba, K. & Okamura, Y. Phosphoinositide phosphatase activity coupled to an intrinsic voltage sensor. Nature 435 , 1239–1243 (2005).

Article ADS CAS PubMed Google Scholar

Okamura, Y., Kawanabe, A. & Kawai, T. Voltage-sensing phosphatases: biophysics, physiology, and molecular engineering. Physiol. Rev. 98 , 2097–2131 (2018).

Article CAS PubMed Google Scholar

Okamura, Y. Biodiversity of voltage sensor domain proteins. Pflug. Arch.: Eur. J. Physiol. 454 , 361–371 (2007).

Article ADS CAS Google Scholar

Okamura, Y. & Dixon, J. E. Voltage-sensing phosphatase: its molecular relationship with PTEN. Physiology 26 , 6–13 (2011).

Okamura, Y., Fujiwara, Y. & Sakata, S. Gating mechanisms of voltage-gated proton channels. Annu. Rev. Biochem. 84 , 685–709 (2015).

Okamura, Y., Murata, Y. & Iwasaki, H. Voltage-sensing phosphatase: actions and potentials. J. Physiol. 587 , 513–520 (2009).

Kawai, T. et al. Polarized PtdIns(4,5)P(2) distribution mediated by a voltage-sensing phosphatase (VSP) regulates sperm motility. Proc. Natl Acad. Sci. USA 116 , 26020–26028 (2019).

Article ADS CAS PubMed PubMed Central Google Scholar

Zeng, X. H., Yang, C., Kim, S. T., Lingle, C. J. & Xia, X. M. Deletion of the Slo3 gene abolishes alkalization-activated K+ current in mouse spermatozoa. Proc. Natl Acad. Sci. USA 108 , 5879–5884 (2011).

Santi, C. M. et al. The SLO3 sperm-specific potassium channel plays a vital role in male fertility. FEBS Lett. 584 , 1041–1046 (2010).

Article CAS PubMed PubMed Central Google Scholar

Hossain, M. I. et al. Enzyme domain affects the movement of the voltage sensor in Ascidian and Zebrafish voltage-sensing phosphatases. J. Biol. Chem. 283 , 18248–18259 (2008).

Kurokawa, T. et al. 3’ Phosphatase activity toward phosphatidylinositol 3,4-bisphosphate [PI(3,4)P 2 ] by voltage-sensing phosphatase (VSP). Proc. Natl Acad. Sci. USA 109 , 10089–10094 (2012).

Yamaguchi, S. et al. Potential role of voltage-sensing phosphatases in regulation of cell structure through the production of PI(3,4)P 2 . J. Cell. Physiol. 229 , 422–433 (2014).

Ratzan, W. J., Evsikov, A. V., Okamura, Y. & Jaffe, L. A. Voltage sensitive phosphoinositide phosphatases of Xenopus: their tissue distribution and voltage dependence. J. Cell. Physiol. 226 , 2740–2746 (2011).

Rosasco, M. G., Gordon, S. E. & Bajjalieh, S. M. Characterization of the functional domains of a mammalian voltage-sensitive phosphatase. Biophys. J. 109 , 2480–2491 (2015).

Nikolopoulou, M., Soucek, D. A. & Vary, J. C. Changes in the lipid content of boar sperm plasma membranes during epididymal maturation. Biochim. et. Biophys. Acta 815 , 486–498 (1985).

Article CAS Google Scholar

Rooke, J. A., Shao, C. C. & Speake, B. K. Effects of feeding tuna oil on the lipid composition of pig spermatozoa and in vitro characteristics of semen. Reproduction 121 , 315–322 (2001).

Lin, D. S., Connor, W. E., Wolf, D. P., Neuringer, M. & Hachey, D. L. Unique lipids of primate spermatozoa: desmosterol and docosahexaenoic acid. J. lipid Res. 34 , 491–499 (1993).

Article PubMed Google Scholar

Morioka, S. et al. A mass spectrometric method for in-depth profiling of phosphoinositide regioisomers and their disease-associated regulation. Nat. Commun. 13 , 83 (2022).

Wu, Y. et al. PTEN 2, a Golgi-associated testis-specific homologue of the PTEN tumor suppressor lipid phosphatase. J. Biol. Chem. 276 , 21745–21753 (2001).

Arima, H., Tsutsui, H. & Okamura, Y. Conservation of the Ca(2+)-permeability through the voltage sensor domain of mammalian CatSper subunit. Channels 12 , 240–248 (2018).

Article PubMed PubMed Central Google Scholar

Kawanabe, A. et al. Engineering an enhanced voltage-sensing phosphatase. J. Gen. Physiol. 152 , e201912491 (2020).

Langlhofer, G. & Villmann, C. The intracellular loop of the glycine receptor: it’s not all about the size. Front. Mol. Neurosci. 9 , 41 (2016).

Nasu-Nishimura, Y. et al. Identification of an endoplasmic reticulum-retention motif in an intracellular loop of the kainate receptor subunit KA2. J. Neurosci. 26 , 7014–7021 (2006).

Marku, A. et al. The LRRK2 N-terminal domain influences vesicle trafficking: impact of the E193K variant. Sci. Rep. 10 , 3799 (2020).

Li, Q. et al. Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain. Nat. Struct. Mol. Biol. 21 , 244–252 (2014).

Tsutsui, H., Higashijima, S., Miyawaki, A. & Okamura, Y. Visualizing voltage dynamics in zebrafish heart. J. Physiol. 588 , 2017–2021 (2010).

Tsutsui, H., Jinno, Y., Tomita, A. & Okamura, Y. Rapid evaluation of a protein-based voltage probe using a field-induced membrane potential change. Biochim. et. Biophysica Acta 1838 , 1730–1737 (2014).

Dimitrov, D. et al. Engineering and characterization of an enhanced fluorescent protein voltage sensor. PLoS One 2 , e440 (2007).

Article ADS PubMed PubMed Central Google Scholar

Kohout, S. C., Ulbrich, M. H., Bell, S. C. & Isacoff, E. Y. Subunit organization and functional transitions in Ci-VSP. Nat. Struct. Mol. Biol. 15 , 106–108 (2008).

Villalba-Galea, C. A., Sandtner, W., Starace, D. M. & Bezanilla, F. S4-based voltage sensors have three major conformations. Proc. Natl Acad. Sci. USA 105 , 17600–17607 (2008).

Villalba-Galea, C. A. Voltage-controlled enzymes: the new JanusBifrons. Front. Pharmacol. 3 , 161 (2012).

Mutua, J. et al. Functional diversity of voltage-sensing phosphatases in two urodele amphibians. Physiol. Rep. 2 , e12061 (2014).

Kohout, S. C. et al. Electrochemical coupling in the voltage-dependent phosphatase Ci-VSP. Nat. Chem. Biol. 6 , 369–375 (2010).

Rejraji, H. et al. Lipid remodeling of murine epididymosomes and spermatozoa during epididymal maturation. Biol. Reprod. 74 , 1104–1113 (2006).

Hasegawa, H. et al. Phosphatidylinositol 4-phosphate 5-kinase is indispensable for mouse spermatogenesis. Biol. Reprod. 86 , 131–112 (2012).

Article Google Scholar

Paixao, I. C. et al. Role of K364 next to the active site cysteine in voltage-dependent phosphatase activity of Ci-VSP. Biophys. J. 122 , 2267–2284 (2023).

Shen, R., Meng, Y., Roux, B. & Perozo, E. Mechanism of voltage gating in the voltage-sensing phosphatase Ci-VSP. Proc. Natl Acad. Sci. USA 119 , e2206649119 (2022).

Levine, N. & Marsh, D. J. Micropuncture studies of the electrochemical aspects of fluid and electrolyte transport in individual seminiferous tubules, the epididymis and the vas deferens in rats. J. Physiol. 213 , 557–570 (1971).

Jenkins, A. D., Lechene, C. P. & Howards, S. S. Concentrations of seven elements in the intraluminal fluids of the rat seminiferous tubules, rate testis, and epididymis. Biol. Reprod. 23 , 981–987 (1980).

Scott, T. W., Wales, R. G., Wallace, J. C. & White, I. G. Composition of Ram epididymal and testicular fluid and the biosynthesis of glycerylphosphorylcholine by the rabbit epididymis. J. Reprod. Fertil. 6 , 49–59 (1963).

Verberckmoes, S., Van Soom, A., Dewulf, J., De Pauw, I. & de Kruif, A. Storage of fresh bovine semen in a diluent based on the ionic composition of cauda epididymal plasma. Reprod. Domest. Anim. 39 , 410–416 (2004).

Cong, L. et al. Multiplex genome engineering using CRISPR/Cas systems. Science 339 , 819–823 (2013).

Mashiko, D. et al. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single-guided RNA. Sci. Rep. 3 , 3355 (2013).

Inanobe, A. et al. Molecular cloning and characterization of a novel splicing variant of the Kir3.2 subunit predominantly expressed in mouse testis. J. Physiol. 1 , 19–30 (1999).

Kirichok, Y., Navarro, B. & Clapham, D. E. Whole-cell patch-clamp measurements of spermatozoa reveal an alkaline-activated Ca2+ channel. Nature 439 , 737–740 (2006).

Ikawa, M. et al. Calsperin is a testis-specific chaperone required for sperm fertility. J. Biol. Chem. 286 , 5639–5646 (2011).

Bastos, H. et al. Flow cytometric characterization of viable meiotic and postmeiotic cells by Hoechst 33342 in mouse spermatogenesis. Cytom. A 65 , 40–49 (2005).

Gaysinskaya, V. & Bortvin, A. Flow cytometry of murine spermatocytes. Curr. Protoc. Cytom. 72 , 44 41–47 44 24 (2015).

Google Scholar

Clark, J. D. et al. A novel arachidonic acid-selective cytosolic PLA 2 contains a Ca 2+ -dependent translocation domain with homology to PKC and GAP. Cell 65 , 1043–1051 (1991).

Miyata, H. et al. SPATA33 localizes calcineurin to the mitochondria and regulates sperm motility in mice. Proc. Natl Acad Sci. USA 118 , e2106673118 (2021).

Toyoda, T., Yokoyama, M. & Hosi, T. Studies on the fertilization of mouse eggs in vitro. I. In vitro fertilization of eggs by fresh epididymal sperm. Jpn J. Anim. Reprod. 16 , 147–151 (1971).

Murata, Y. & Okamura, Y. Depolarization activates the phosphoinositide phosphatase Ci-VSP, as detected in Xenopus oocytes coexpressing sensors of PIP 2 . J. Physiol. 583 , 875–889 (2007).

Mirdita, M. et al. ColabFold: making protein folding accessible to all. Nat. Methods 19 , 679–682 (2022).

Download references

Acknowledgements

We express our gratitude to Ms. Hikari Ginama, Ms. Megumi Kobayashi, and Dr. Natsuki Mizutani from Osaka University, Dr. Hiroki Nakanishi from Akita University, and NPO Biotechnology Research and Development for their technical support. We also thank Ms. Risa Mori-Kreiner for critical reading of the manuscript. This study received support from the Center for Medical Research and Education at the Graduate School of Medicine, Osaka University, and JSPS KAKENHI Grant Number JP20KK0376 (AdAMS) to T.K. Funding was provided by Grants-in-Aid from JSPS KAKENHI Grant Numbers JP17K15558, JP20K07274, JP20KK0376, JP23K06334 and JST FOREST Program, Grant Number JPMJFR225Z. Additionally, financial support was received from The Ichiro Kanehara Foundation, the Hyogo Science and Technology Association, the Sumitomo Foundation, the Ono Medical Research Foundation, the Uehara Memorial Foundation, the Senri Life Science Foundation, the Takeda Science Foundation, and Mochida Memorial Foundation for Medical and Pharmaceutical Research, all of which contributed to T.K.ʼs research. T.S. was supported by AMED under Grant Number 24gm1710007, by TMDU under Multilayered Stress Diseases (JPMXP1323015483), and Medical Research Center Initiative for High Depth Omics. This work was also supported by MEXT KAKENHI Grant Numbers JP15H05901, JP20H05791) and JSPS KAKENHI Grant Numbers JP21229003, JP25253016, JP19H03401 to Y.Okamura.

Author information

Sharmin Akter

Present address: Department of Physiology, Bangladesh Agricultural University, Mymensingh, Bangladesh

Gabriel Toma

Present address: Graduate School of Frontier Biosciences, Osaka University, Suita, Japan

Authors and Affiliations

Graduate School of Medicine, Osaka University, Suita, Japan

Takafumi Kawai, Rizki Tsari Andriani, Sharmin Akter & Yasushi Okamura

Department of Biochemical Pathophysiology/Lipid Biology, Medical Research Institute, Tokyo Medical and Dental University, Tokyo, Japan

Shin Morioka, Junko Sasaki & Takehiko Sasaki

Research Institute for Microbial Diseases, Osaka University, Suita, Japan

Haruhiko Miyata, Tatsuya Nakagawa, Yuki Oyama, Rie Iida-Norita & Masahito Ikawa

Center for Medical Research and Education, Osaka University, Suita, Japan

Graduate School of Pharmaceutical Sciences, Osaka University, Suita, Japan

Tatsuya Nakagawa, Yuki Oyama & Masahito Ikawa

Faculty of Medicine, Hokkaido University, Sapporo, Japan

Masahiko Watanabe

Brain Research Institute, Niigata University, Niigata, Japan

Kenji Sakimura

Graduate School of Frontier Bioscience, Osaka University, Suita, Japan

Yasushi Okamura

You can also search for this author in PubMed Google Scholar

Contributions

T.K. and Y.Okamura conceived the study; T.K. and Y.Okamura designed experiments; T.K., H.M, Y.Oyama, and R.I.N performed and M.I. supervised experiments for in vitro fertilization and sperm motility analysis; T.K, S.A. and G.T performed FACS for spermatids isolation; S.M. performed experiments for LC/MS-MS analysis and J.S and T.S supervised them; T.N and H.M generated knock-in mice and knock-out mice; K. S provided VSP-deficient mice; M.W provided the antibody for VSP; T.K and R.T.A performed VCF experiments; T.K performed experiments for immunocytochemistry, Western blotting, and electrophysiology. T.K. drafted the manuscript; All members critically read the manuscript.

Corresponding author

Correspondence to Takafumi Kawai .

Ethics declarations

Competing interests.

The authors declare no competing interests.

Peer review

Peer review information.

Nature Communications thanks Laurinda Jaffe, Michael Nomikos and Elisabeth Pinart for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary information, peer review file, reporting summary, source data, source data, rights and permissions.

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/ .

Reprints and permissions

About this article

Cite this article.

Kawai, T., Morioka, S., Miyata, H. et al. The significance of electrical signals in maturing spermatozoa for phosphoinositide regulation through voltage-sensing phosphatase. Nat Commun 15 , 7289 (2024). https://doi.org/10.1038/s41467-024-51755-2

Download citation

Received : 29 April 2024

Accepted : 14 August 2024

Published : 24 August 2024

DOI : https://doi.org/10.1038/s41467-024-51755-2

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

By submitting a comment you agree to abide by our Terms and Community Guidelines . If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Quick links

Explore articles by subject
Guide to authors
Editorial policies

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here .

Loading metrics

Open Access

Peer-reviewed

Research Article

The validity and safety of multispectral light emitting diode (LED) treatment on grade 2 pressure ulcer: Double-blinded, randomized controlled clinical trial

Contributed equally to this work with: Nam Kyu Lim, Phil-Sang Chung

Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

* E-mail: [email protected] (NKL); [email protected] (PSC)

Affiliation Department of Plastic and Reconstructive Surgery, Dankook University Hospital, Cheonan, Chungnam, Republic of Korea

Roles Investigation, Software, Visualization, Writing – original draft

Affiliation Department of Medical Laser, Graduate School of Medicine, Dankook University, Cheonan, Chungnam, Republic of Korea

Roles Investigation, Visualization, Writing – original draft

Roles Supervision

Affiliation Medical Laser Research Center, Dankook University, Cheonan, Chungnam, Republic of Korea

Roles Methodology, Supervision

Roles Data curation, Formal analysis, Methodology

Affiliation Institute of Medical Science, Dankook University Hospital, Cheonan, Chungnam, Republic of Korea

Roles Data curation, Investigation, Resources

Roles Data curation

Roles Conceptualization, Funding acquisition, Resources

Affiliation Linkoptics Inc., Gwangju, Cheonnam, Republic of Korea

Roles Funding acquisition, Supervision

Affiliations Medical Laser Research Center, Dankook University, Cheonan, Chungnam, Republic of Korea, Institute of Medical Science, Dankook University Hospital, Cheonan, Chungnam, Republic of Korea, Beckman Laser Institute Korea, Dankook University College of Medicine, Cheonan, Chungnam, Republic of Korea, Department of Otolaryngology-Head & Neck Surgery, Dankook University College of Medicine, Cheonan, Chungnam, Republic of Korea

Nam Kyu Lim,
Hyeyoon Goo,
Sung-Ryeong Yoon,
Jin Chul Ahn,
Namgue Hong,
Young Hoon Choi,
Hyung Bin Bang,
Sungyeon Kim,
Yong Won Choi,
Phil-Sang Chung

Published: August 23, 2024
https://doi.org/10.1371/journal.pone.0305616
Reader Comments

The management of pressure ulcers (PUs) poses challenges due to their chronic nature and the lack of established conservative treatment methods. In this clinical trial, our objective was to examine the validity and safety of using a light-emitting diode device contained four wavelengths in the treatment of grade 2 sacral PUs.

A total of 38 patients were randomly assigned to two groups: sham device (Sham) and experimental device (LED) group. The treatment sessions were conducted over a period of four weeks, with a frequency of three times per week. The study was conducted in a double-blinded manner. The study assessed the primary validity by measuring wound size and re-epithelialization after 0 and 4 weeks. Secondary evaluations included epidermal regeneration, collagen density, and immunological markers. Safety was evaluated by monitoring adverse reactions throughout the trial.

The presence of eschar was found to have a significant impact on wound healing. Sham consisted of 15 wounds without eschar, while LED had nine. After treatment in without eschar situation, the post-treatment size of wounds in Sham was 13.80 ± 20.29%, while it was 3.52 ± 6.68% in LED. However, there was no significant difference ( p = 0.070). And analysis of epidermal thickness showed a significant increase in LED (495.62 ± 327.09 μm) compared to Sham (195.36 ± 263.04 μm) ( p < 0.0001).

While LED treatment had a potential for wound reduction in PUs without eschar, we could not uncover evidence to support the efficacy of LED treatment in grade 2 PUs.

Citation: Lim NK, Goo H, Yoon S-R, Ahn JC, Hong N, Choi YH, et al. (2024) The validity and safety of multispectral light emitting diode (LED) treatment on grade 2 pressure ulcer: Double-blinded, randomized controlled clinical trial. PLoS ONE 19(8): e0305616. https://doi.org/10.1371/journal.pone.0305616

Editor: Michael R. Hamblin, Massachusetts General Hospital, UNITED STATES

Received: December 18, 2023; Accepted: May 14, 2024; Published: August 23, 2024

Copyright: © 2024 Lim et al. This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: The data are not publicly available due to ethical and legal restrictions because data contain potentially identifying patient information. Therefore, data maybe accessed upon authorization from the Institutional Review Board that may be contacted through [email protected] .

Funding: This work was supported by the Korea Medical Device Development Fund grant funded by the Korea government (the Ministry of Science and ICT, the Ministry of Trade, Industry, and Energy, the Ministry of Health & Welfare, Republic of Korea, the Ministry of Food and Drug Safety) (RS-2020-KD000213) and a grant of the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI) funded by the Ministry of Health & Welfare, Republic of Korea (HI20C2088) and Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2020R1A6A1A03043283). We appreciated your feedback. All three funding sources were involved in this study. NK Lim and P-S Chung contributed to the study design and conceptualization as corresponding authors. JC Ahn, as one of the funders, was involved in data analysis, particularly in histological analysis.

Competing interests: Choi YW is a chief executive officer and has stock in Linkoptics corporation. our competing interests do not alter our adherence to PLOS ONE policies on sharing data and materials. However, the data are not publicly available due to ethical and legal restrictions because data contain potentially identifying patient information. Therefore, data may be accessed upon authorization from the Institutional Review Board that may be contacted through ‘ [email protected] ’

Introduction

In the United States, pressure ulcers have become a pressing public health concern, impacting approximately 2.5 million individuals annually and tragically leading to around 60,000 deaths. These wounds pose a significant societal burden, with an annual cost reaching approximately $11.6 billion [ 1 – 3 ]. There are various ways to classify pressure ulcers, the most used method in recent years is the grade classification system published by the National Pressure Ulcer Advisory Panel [ 1 ]. Grade 2 ulcers result in skin damage, and if left untreated, they can escalate to grade 3 or higher, leading to tissue necrosis [ 1 , 4 ]. Pressure ulcers are typical chronic wounds, and its recovery is not always achieved and requires a combination of factors such as reducing direct pressure, managing underlying medical conditions and nutrition, and continuous wound management until relief from sustained pressure is achieved [ 2 , 4 , 5 ]. Though many dressing materials have been developed, there is no established method for the conservative treatment of pressure ulcers, as each treatment has its limitations [ 1 , 2 , 6 ].

Numerous reports have suggested that photobiomodulation therapy (PBMT) uses low-level light to induce healing and promote oxidative regulation and growth factor production, aiding wound healing [ 7 – 11 ]. It is also known to have anti-inflammatory, analgesic, and antibacterial effects, the effectiveness of PBMT in treating pressure ulcers has been reported [ 11 – 13 ]. In most studies, the treatment was delivered at an energy density of either 1 J/cm 2 or 4 J/cm 2 , with a frequency of three to five sessions per week over 4 to 6 weeks. And these therapies utilized wavelengths ranging from 650 to 820 nm [ 10 , 11 ]. In PBMT, wavelength is an important parameter alongside energy density. Several reports suggested that the 630 – 660 nm range, known as the ‘RED’ region, was favorable for fibroblast proliferation and wound healing [ 10 , 14 , 15 ]. Additionally, wavelengths in the 810 – 850 nm range, referred to as infrared, have good penetration capabilities and can affect regeneration up to the deep dermal layer [ 15 , 16 ]. Meanwhile, UV or blue wavelengths were reported to antimicrobial effects [ 17 , 18 ]. We also performed preclinical test in 2019 using rats, and found that combination therapy with plasma sterilization and multiple wavelengths (592 and 630 nm) was significantly induced infected wound compared to the single treatment group ( S1 Fig ) . A simultaneous multi-wavelength combination therapy had distinct effects on cell proliferation, differentiation and signaling compared to single wavelengths, which have been reported in several literatures [ 19 – 21 ]. However, the use of plasma to induce sterilization is not suitable for clinical trials due to the potential risk of ozone generation in humans. The clinical trial device, BELLALUX Lite, was a follow-up model of the preclinical test model and had added a 460 nm BLUE wavelength, which can improve sterilization power. Therefore, the basis for the clinical trial has been established.

In this clinical trial, the device used was the "BELLALUX Lite," certified by the Worldwide System for Conformity Testing and Certification of Electrical Equipment (IECEE-CB) in July 2019. It is a medical stimulator that combines four light-emitting diode (LED) wavelengths: visible light (RED [630 nm], AMBER [595 nm]; BLUE [460 nm]) and near-infrared light (850 nm). This Grade 2 medical device has potential antibacterial (BLUE) and wound recovery (RED, near-infrared light) capabilities, particularly for chronic wounds such as pressure ulcers. We aimed to analyze the treatment process to determine the validity and safety of utilizing this device in the second-grade sacral pressure ulcers and assess chronic wound recovery.

The clinical trial was conducted for 24 months (October 28th, 2020 to October 26th, 2022) in accordance with institutional review board (IRB) approval (DKUH 2020-09-014) and with the Ministry of Food and Drug Safety in Republic of Korea (1104). The study protocol commenced with version 2.0 and underwent two revisions, culminating in version 4.0. Throughout this period, the inclusion criteria were modified from individuals aged 19 years or older to those aged 13 years or older, although no minors participated in the study. The protocol is available as supportive information. All participants provided written informed consent. We had recruited participants from January 11th, 2021 to August 24th, and monitored until the end of study period. This clinical trial was registered in Clinical Research Information Service (CRIS, cris.nih.go.kr), and the registered number is KCT0009002. The reason why time lag between the initial enrollment on January 11th, 2021, and the submission on December 16th, 2021, was primarily prolonged due to the process of revising protocols and obtaining approval from the IRB. The medical and sham device groups were randomly divided into control (Sham) and experimental (LED) groups. The random allocation method was as follows: a subject identification code was assigned when a person met the inclusion criteria and consented to participate. The assignment sequence of the experimental and control groups was randomized based on subject registration numbers. A sufficient number of random assignment numbers were generated, considering the size of the pre-specified block using the statistical software R, version 4.04 (R Foundation, Vienna, Austria). The study was designed a double-blinded manner, with participants (patients) blinded and researcher (NK Lim, et al.) blinded (sham vs. LED). A data analysis and assigning randomized registration number were conducted by a contract research organization (CRO) company. After preparation, a randomization table was managed separately by a third independent randomization management officer (CRO company). A blind test was released at the completion of the clinical trial; however, verifying it before the conclusion in the event of an emergency was permissible.

Considering a 15% dropout rate, the target number of participants was 16 for each final evaluation subject group and 19 per control and experimental group, for 38 participants ( Fig 1 ) . The rationale for these 16 patients was based on a systematic review published in 2020 [ 12 ]. Participants were sourced through in-person promotion and posters targeting individuals seeking pressure ulcer treatment at Dankook University Hospital, with all details meticulously documented in an electronic chart. The inclusion and exclusion criteria are presented in Table 1 .

PPT PowerPoint slide
PNG larger image
TIFF original image

https://doi.org/10.1371/journal.pone.0305616.g001

https://doi.org/10.1371/journal.pone.0305616.t001

After conducting the required examinations and testing in compliance with the clinical trial protocol, the participants were exposed to the simultaneous emitting four light wavelengths for 25 min at twelve times per a month. An experimental LED device was set at maximum output with total 90 mW/cm 2 ( Table 2 , all four wavelengths with 5 stage). Thus, a total energy of 135 J/cm 2 was applied over 25 minutes (1620 J/cm 2 total for 12 sessions). On the other hand, a control device (Sham) was equipped with the same shape as that in the experiment ( Fig 2 ) , and it implemented the same LED visually as the therapeutic device by using the minimum power (stage 1; total 12 mW/cm 2 across 4 wavelengths). This translates to a total energy of 18 J/cm 2 per session, and 216 J/cm 2 in total over the entire trial period. A light exposure occurred 15 cm from the wound region.

The two devices are difficult to distinguish based solely on their appearance aspect.

https://doi.org/10.1371/journal.pone.0305616.g002

https://doi.org/10.1371/journal.pone.0305616.t002

The clinical trial included 15 visits over 210 days. Visit 1 (day 0) was for screening; visits 2 (day 1) through 13 (day 26) were for treatment; and visits 14 (day 29) and 15 (day 210) were for follow-up. After checking the criteria for subject selection during screening (visit 1), LED therapy was administered thrice weekly for 4 weeks between visits 2 and 13. The patient’s medical histories were meticulously researched and recorded during the screening visit using interviews and historical medical documents; this included a history of diabetes, hypertension, surgical history, and drug administration. In addition to blood tests, urine tests, and pelvic radiography, women of reproductive age also underwent pregnancy testing. Before treatment (visit 1) and after treatment (visit 14), bacterial culture tests and tissue biopsies were conducted exclusively on patients with additional consent. At each visit, a physical examination, including an assessment of the affected area, was conducted, including the size (length × width) and depth (superficial, moderate, and deep) of the pressure ulcer, presence of eschar, color, secretion style, odor, microvascular bleeding, and degree of granulation tissue formation. We also applied an antibacterial dressing with 1% silver sulfadiazine plus foam daily following the global guidelines for pressure ulcers published in 2019 to conduct clinical trials with a subject risk below the minimal threshold ( Table 3 ) [ 1 ]. The validity and safety of the clinical trials utilizing these protocols were evaluated using the following criteria.

https://doi.org/10.1371/journal.pone.0305616.t003

(1) Validity assessment

A. the first validity assessment (wound size)..

The primary validity evaluations were wound size and amount of re-epithelialization. The difference between the two groups was determined by calculating the wound size and degree of re-epithelialization in the control and experimental groups at 0 and 4 weeks. However, because the wound area was reduced during biopsy at visit 1, the initial reference was set at visit 2, just before LED treatment, to avoid bias. A Wilcoxon rank-sum test was conducted to assess the difference in wound area before and after the treatment, while the Mann–Whitney U test was employed to compare the control and experimental groups. In addition, repeated-measures analysis of variance was employed to compare the extent of recovery observed during the treatment period. Statistical analyses were performed using SPSS 23.0 (IBM Corporation, Armonk, NY, USA).

B. The second validity assessment (Tissue biopsy).

Secondary validity evaluation assessed the degree of epidermal regeneration, collagen density, and pro- (interleukin [IL]-6) and anti-inflammatory (IL-10) immunochemical indicators in biopsy tissue samples from the control and experimental groups after 0 and 4 weeks. The tissue was harvested until the subcutaneous level in two spots at the pressure ulcer margin using 4-mm punch biopsies, and repair was subsequently performed with a proline 4-0 thread. All samples were stained and subjected to a quantitative real-time polymerase chain reaction using standard methods ( Table 4 ) . Data were analyzed using the GraphPad Prism software (GraphPad, San Diego, CA, USA). Significant differences between groups A and B were statistically analyzed using the Mann–Whitney test and was set at a p- value of < 0.05 as statistical significance.

https://doi.org/10.1371/journal.pone.0305616.t004

(2) Safety assessment

The clinical trial’s design aimed to assess safety by carefully evaluating and monitoring adverse reactions throughout the study. All adverse and unexpected reactions caused by the clinical trial medical devices were classified as adverse device effects to confirm causality with the clinical trial medical devices. The degree of relevance (definitely related, unrelated, probably related, unrelated, or unknown) was assessed.

(1) Subjects’ demographics

Of the 40 subjects who expressed interest in participating, two dropped out of the screening, and 38 were ultimately enrolled in the study, with 19 in each of the two groups. The sex ratio (male: female) in Sham was 6:13, whereas it was 9:10 in LED ( p = 0.508), and the mean age in Sham was 77.84 ± 10.89 years, whereas in LED, it was 60.47 ± 13.03 years ( p = 0.000). We also assessed comorbidities in all patients at visit 1 according to the system organ class of the medical dictionary for regulator activities, a total of 75 (sham) and 84 (LED) comorbidities were observed, respectively (for example, hypertension: 15 in sham, 9 in LED; diabetes: 7 in sham, 9 in LED). Numerical information for each disease category is presented in Table 5 and detailed disease information is listed in S1 Table .

https://doi.org/10.1371/journal.pone.0305616.t005

Some participants had multiple pressure ulcers in the sacral region, which increased the overall number of wounds in the sham and LED to 25 and 26, respectively. Seven participants in Sham and nine in LED consenting to additional biopsy.

During the 4-week treatment period (visits 2–13), there were six dropouts in Sham and five in LED, including five withdrawals, four with legal isolates (coronavirus disease 19 and vancomycin-resistant Enterococcus), and two patients whose health deteriorated to the point where they were unable to continue.

The number of patients who completed the protocol treatment and were eligible for the final evaluation was 13 (three males, 10 females) in Sham and 14 (eight males, six females) in LED, with no statistically significant difference between the two groups ( p = 0.120). Patients with 18 and 20 wounds in control and experimental groups, respectively, were clinically evaluated for primary validity. Six patients from Sham and eight from LED underwent a post-treatment biopsy for secondary validity. ( Table 6 , Fig 3 ) .

V, visit; D, day; N, numbers; A, Sham; B, LED; LED, light emitting diode.

https://doi.org/10.1371/journal.pone.0305616.g003

https://doi.org/10.1371/journal.pone.0305616.t006

The medical device group and the sham device group were divided randomly as the control (Sham) and experiment (LED) groups, respectively. The clinical trial was designed with 15 visits over 210 days. A visit 1 (day 0) is for screening, visit 2 (day 1) through 13 (day 26) are for treatment, and visit 14 (day 29) and 15 (day 210) are for follow-up. After checking the criteria for subject selection during screening (visit 1), LED therapy was administered three times per week for four weeks between visit 2 and 13. Of the total 40 subjects who expressed interest in participating, 2 subjects dropped out of the screening, and 38 subjects were ultimately enrolled in the study, 19 in each of the two groups. Some participants had multiple pressure ulcers in the sacral region, which raised the overall number of wounds in the control (Sham) and experimental (LED) groups to 25 and 26, respectively. During the 4-week treatment period (visit 2 through 13), there were 6 dropouts in the Sham and 5 in the LED, including 5 withdrawals, 4 with legal isolates (COVID-19, vancomycin resistant enterococcus), and 2 patients whose health deteriorated to the point where they were unable to continue. Finally, patients with 18 wounds in the Sham and 20 wounds in the LED were evaluated clinically for the primary validity (wound size), and 6 in Sham and 8 in LED for the secondary validity (tissue biopsy). Six months following treatment, long-term monitoring was conducted; two deaths occurred between visit 14 and 15, and the number of patients in long-term observation was five in the Sham and nine in the LED.

(2) The first validity assessment (Wound size)

A. total wound..

At visit 2, the average size (length × width) of the 18 lesions in Sham was 5.02 ± 6.25 cm 2 , while the average size of the 20 lesions in LED was 11.43 ± 15.12 cm 2 . After 12 LED treatments (visit 14), the size of Sham was 0.88 ± 1.22 cm 2, and LED was 3.78 ± 7.54 cm 2 . The mean difference ‘LED – Sham’ was 2.90 cm 2 at visit 14, and there was no significant difference between the two groups ( p = 0.061). When the initial size of both groups was set to 100%, the post-treatment size was 12.85 ± 18.74% for Sham and 34.46 ± 20.84% for LED. In both groups, there was a significant difference in wound size before and after treatment (Sham, p < 0.001; LED, p < 0.001) ( Table 7 ) .

https://doi.org/10.1371/journal.pone.0305616.t007

B. Regression analysis of variables that contribute to wound healing.

As treatment significantly decreased the wound size in both groups, regression analysis was conducted to determine the variables that significantly impacted wound healing. Age, body mass index, Braden Scale, serum protein, serum albumin, hemoglobin, localized infection, the presence or absence of LED therapy, and eschar were included as factors according to previous literature [ 22 – 25 ]. Among these, only the presence of eschar had a statistically significant effect on wound healing ( Table 8 ) .

https://doi.org/10.1371/journal.pone.0305616.t008

In usual, eschar indicates a more advanced grade 2 pressure ulcer [ 2 , 26 , 27 ]. This study divided the depth into three levels, with the eschar visible only at the deepest level. Consequently, superficial to moderate levels can be classified as wounds without eschars, whereas deep levels can be categorized as wounds with eschars. The wounds were evaluated based on the presence or absence of eschar additionally. Eschar was significantly more prevalent in LED than in Sham ( p = 0.014) ( Table 9 ) .

https://doi.org/10.1371/journal.pone.0305616.t009

C. Without eschar.

Sham had 15 wounds without eschar, whereas LED had nine wounds. At screening (visit 2), the average size (length × width) of the control wounds (Sham) was 5.24 ± 6.75 cm 2 , while the average size of the experimental wounds (LED) was 11.51 ± 13.46 cm 2 . Following 12 LED treatments (visit 14), Sham measured 0.96 ± 1.31 cm 2, while LED measured 0.56 ± 1.45 cm 2 . When the initial size of both groups was set to 100%, the post-treatment size of Sham was 13.80 ± 20.29%, and that of LED was 3.52 ± 6.68%. The change in wound size from pre-to post-treatment was significant in both groups (Sham, p < 0.001; LED, p < 0.001), but there was no significant difference between the two groups ( p = 0.070) ( Table 7 , Fig 4 and S2 Fig ) .

Clinical photographs between two groups according to with or without eschar. In the absence of eschar, it can be seen that LED represented a tendency of re-epithelialization and wound size reduction compared to Sham. All eschar in this investigation was white and slightly advanced from within the slough.

https://doi.org/10.1371/journal.pone.0305616.g004

D. With eschar.

There were 11 experimental wounds (LED) and three control wounds (Sham) at the deepest level. At screening (visit 2), the mean size (length × width) of the wounds in Sham was 3.91 ± 3.24 cm 2 , but the mean size in LED was 11.35 ± 17.01 cm 2 . Following 12 LED treatments (visit 14), Sham measured 0.48 ± 0.49 cm 2 , while LED measured 6.51 ± 9.46 cm 2 . LED demonstrated a significant difference in the wound size before and after treatment ( p = 0.003), whereas Sham did not ( p = 0.109); this may be due to Sham’s small number of wounds, which made obtaining statistically significant results challenging. In addition, there was no statistically significant difference in the treatment outcomes between the two groups ( p = 0.148) ( Table 7 , Fig 4 ) .

(3) The second validity assessment (Tissue biopsy)

In the analysis of epidermal thickness, LED (495.62 ± 327.09 μm) had significantly increased the epidermal thickness compared to Sham (195.36 ± 263.04 μm) ( p < 0.001). Hematoxylin and eosin staining was also used to measure the basement membrane lengthening; it was found that the basement membrane significantly increased in LED (8651.48 ± 7753.17 μm) compared to Sham (3338.14 ± 4132.74 μm) ( p < 0.05) ( Fig 5 and S3 Fig ) .

Scale bar : 500 μm. n, numbers. * : p < 0.05; *** : p < 0.001. (Left) The LED (495.62 ± 327.09 μm) was significantly increased the epidermal thickness compared to Sham (195.36 ± 263.04 μm) ( p < 0.001). (Right) It was found that the basement membrane significantly increased in LED (8651.48 ± 7753.17 μm) compared to Sham (3338.14 ± 4132.74 μm) ( p < 0.05).

https://doi.org/10.1371/journal.pone.0305616.g005

Though it was confirmed that the dermis collagen intensity was gradually increased in both Sham (visit 1; 93.07 ± 19.54, visit 14; 105.69 ± 20.49) and LED (visit 1; 110.45 ± 36.73, visit 14; 119.88 ± 29.79), there was no significant difference between the two groups ( p = 0.112) ( Fig 6 and S4 Fig ) .

Scale bar : 500 μm. V, visit; n, numbers. Though it was confirmed that the dermis collagen intensity was gradually increased in both Sham (visit 1; 93.07 ± 19.54, visit 14; 105.69 ± 20.49) and LED (visit 1; 110.45 ± 36.73, visit 14; 119.88 ± 29.79), there was no significant difference between the two groups ( p = 0.112).

https://doi.org/10.1371/journal.pone.0305616.g006

In the quantitative real-time polymerase chain reaction, IL-6 showed a slight increase in both groups of total samples at visit 14 compared to visit 1. Meanwhile, in Sham, IL-10 decreased, while it remained stable in LED. Although the IL-10 / IL-6 ratio decreased at visit 14 compared to visit 1 in both groups, the difference was not statistically significant ( Fig 7 and S5 Fig ) .

V, visit; n, numbers; IL, interleukin. IL-6 slightly increased in both groups of total samples at visit 14 compared to visit 1, and IL-10 decreased in Sham while steady in LED. The IL-10 / IL-6 ratio was decreased in visit 14 compared to visit 1 in both groups, but all data was statistically insignificant.

https://doi.org/10.1371/journal.pone.0305616.g007

In immunohistochemistry, similarly to the ribonucleic acid-level findings, the protein-level analysis revealed an upward trend following the treatment of both IL-86 (Sham, visit 1; 6.43 ± 7.06, visit 14; 6.9 ± 5.20 vs. LED, visit 1; 9.32 ± 6.59, visit 14; 20.57 ± 13.10) and IL-10 (Sham, visit 1; 3.36 ± 3.45, visit 14; 7.87 ± 9.79 vs. LED, visit 1; 7.61 ± 5.84, visit 14; 30.52 ± 27.05). In particular, there was a significant difference in IL-6 levels before and after treatment in LED ( p < 0.01) ( Fig 8 and S6 Fig ) .

Scale bar : 500 μm; ** : p < 0.01. V, visit; n, number; IL, interleukin; DAB, diaminobenzidine. Protein-level analysis revealed an upward trend following the treatment of both IL-6 (Sham, visit 1; 6.43 ± 7.06, visit 14; 6.9 ± 5.20 vs. LED, visit 1; 9.32 ± 6.59, visit 14; 20.57 ± 13.10) and IL-10 (Sham, visit 1; 3.36 ± 3.45, visit 14; 7.87 ± 9.79 vs. LED, visit 1; 7.61 ± 5.84, visit 14; 30.52 ± 27.05). Particularly, there was a significant difference between the level of IL-6 elevated before and after treatment in LED ( p < 0.01).

https://doi.org/10.1371/journal.pone.0305616.g008

(4) Safety assessment (Adverse reaction)

Throughout the 4-week treatment phase, 17 adverse events were documented among 15 participants—seven in the control group and ten in the experimental group. Notably, one participant faced severe adverse effects, prompting the study withdrawal. Among nine participants with moderate adverse events, five participants had legitimate isolation infections such as vancomycin-resistant enterococcus and COVID-19. A single adverse reaction was closely tied to the medical device. In total, 39.5% (15/38) of participants experienced adverse events; only 2.6% (1/38) of these were device-related, affirming its safety ( Table 10 ) .

https://doi.org/10.1371/journal.pone.0305616.t010

Diverse methodologies have been explored for the management of pressure ulcers due to their intricate underlying physiological mechanisms [ 1 , 28 , 29 ]. Notably, photobiomodulation therapy, including the use of LED, has garnered significant attention, particularly for its potential in promoting wound healing [ 7 , 14 , 30 , 31 ]. Our investigation revealed that our device employing multispectral wavelengths exhibited a favorable impact on both epidermal thickness and the basement membrane, aligning with findings from prior research [ 32 – 35 ]. This treatment was also recognized for its capacity to augment collagen generation within the skin while concurrently suppressing the synthesis of matrix metalloproteinase [ 36 ]. Nevertheless, our study did not uncover any statistically significant distinction when compared to sham devices. This lack of significance can be attributed partly to variations in standardized parameters and a lack of consensus on the optimal wavelength and intensity settings among different studies. Furthermore, the degree of light transmission with and without eschar formation can vary, contributing to variability in results.

Eschar formation is a common feature of pressure ulcers. This phenomenon is a natural response to the body’s attempt to protect the underlying tissues from further damage and infection. Under a microscope, eschar typically consists of proteins, lipids, nucleic acids, and other cellular components denatured and coagulated by heat, pressure, or other factors. The presence of eschar can impede the healing of a pressure ulcer because it creates a barrier that prevents the growth of new tissue and hinders the delivery of oxygen and nutrients to the affected area [ 20 , 37 , 38 ]. In our study, the existence of an eschar, which signals a deeper lesion in the case of a second-degree pressure ulcer, restricted the penetration of LED light and lowered its efficiency by half; this is a shortcoming of a prospective, double-blind trial, and we suspect that the effect of LED therapy would have been more clearly defined if the patients had been selected and allocated.

The balance between the pro- and anti-inflammatory cytokines plays an important role in cell regeneration [ 39 , 40 ]. Macrophage polarization is also an indicator of proliferation [ 14 , 41 ]. In our study, when evaluating the ratio of IL-6 to IL-10 as an indicator of macrophage polarization, we did not observe consistent changes in the levels of these cytokines. This finding differs from the results reported in a study on the effectiveness of oral ulcers conducted by Wagner VP et al. [ 42 ]. The primary reason for the variability in the effectiveness of LEDs in treating pressure ulcers is the chronic nature of the wounds, which involves an ongoing inflammatory response. In chronic wounds, pressure ulcers are influenced by numerous factors that can affect LED treatment outcomes [ 8 , 10 ]. These variables include underlying medical conditions, an individual’s immune response, and the overall wound-healing process [ 11 , 28 , 29 ]. All these factors contribute to the complexity and variability observed in the effectiveness of LED therapy for pressure ulcers.

This prospective study has several limitations. First, using biopsies to study the effectiveness of LED treatment for pressure ulcers was that they only provide a limited, localized view of the wound. Biopsies involve sampling a small portion of the tissue, which may not fully represent the entire pressure ulcer. Clinical observations, on the other hand, provide a broader perspective by considering the overall response to LED treatment, including factors such as wound healing progress and symptom relief. Therefore, although biopsies were valuable for providing detailed cellular and molecular information, they have limitations in assessing the impact of LED therapy on the presence or absence of eschar in pressure ulcers. Second, to minimize bias in variables affecting pressure ulcers, a double-blinded prospective study had been designated. However, during the clinical trial, dropout occurred, and controlling for these variables arbitrarily was impossible because of prospective study. Consequently, differences in variables such as age, wound size, and the ratio of eschar occurrence arose between the two groups. Therefore, it is crucial to consider these limitations and analyze the results from different perspectives. Third, for the sham device, we developed a new parameter to implement the device visually identical to the therapeutic device by utilizing the minimum power required to emit LED light. While this energy did not induce changes in ambient temperature or warming of the tissue, it cannot be entirely ruled out that the energy generation itself may have some impact on the tissue. Finally, this study serves as an exploratory investigation and provides the groundwork for future confirmatory clinical trials. In our study, there was no evidence found to suggest that LED treatment was beneficial for grade 2 pressure ulcers. However, when the analysis was stratified by the presence or absence of eschar, a trend was observed suggesting that LED therapy might be beneficial in cases where eschar was absent. Based on these findings and the characteristics of the eschar, it is plausible that the eschar can increase the reflection of the LEDs and decrease the transmittance, thereby halving the therapeutic effect, and it can be assumed that the contribution of the LED treatment effect would be greater in the absence of eschar ( Fig 9 ) . However, additional research with a larger sample size should be done to acquire more robust and conclusive evidence regarding the effectiveness of LED treatment for pressure ulcers. The scenarios for power generation are presented in S2 Table .

https://doi.org/10.1371/journal.pone.0305616.g009

In summary, our investigation did not uncover supportive evidence for the efficacy of multispectral LED treatment in grade 2 pressure ulcers, with the presence of eschar formation emerging as a pivotal factor influencing recovery. Consequently, we advocate for a clinical trial involving a larger cohort of participants with grade 2 pressure ulcers without eschar to substantiate the efficacy of LED treatment.

Supporting information

S1 table. comorbidity diseases of patients..

https://doi.org/10.1371/journal.pone.0305616.s001

S2 Table. Calculation of sample size for confirmatory clinical trial.

https://doi.org/10.1371/journal.pone.0305616.s002

S1 Fig. The results of preclinical study using LED device.

(A) A scheme of experimental design and four groups (B) Photographs of four groups according to time-serial change (C) A graph comparing wound sizes across the four groups. Among the four groups, the combined therapy (plasma + multispectral LED) was found to be most effective for infectious wound healing.

https://doi.org/10.1371/journal.pone.0305616.s003

S2 Fig. Wound area assessment graph between two groups.

n, numbers; ** : p < 0.01; *** : p < 0.001. Graph of wound area assessment between two groups. At screening (visit 2), the average size (length × width) of the 18 lesions in the Sham was 5.02 ± 6.25 cm 2 , while the average size of the 20 lesions in the LED was 11.43 ± 15.12 cm 2 . After 12 LED treatments (visit 14), the size of the Sham was 0.88 ± 1.22 cm 2 and the LED was 3.78 ± 7.54 cm 2 . When the initial size of both groups was set to 100%, the post-treatment size was 12.85 ± 18.74% for the Sham and 34.46 ± 20.84% for the LED. In both groups, there was a significant difference between the wound size before and after treatment (Sham, p < 0.001, and LED, p < 0.001), but there was no significant difference between the two groups ( p = 0.061). The Sham had 15 wounds without eschar, while the LED had nine. At screening (visit 2), the average size (length × width) of the control wounds (Sham) was 5.24 ± 6.75 cm 2 , while the average size of the experimental wounds (LED) was 11.51 ± 13.46 cm 2 . Following 12 LED treatments (visit 14), the Sham measured 0.96 ± 1.31 cm 2 while the LED measured 0.56 ± 1.45 cm 2 . When the initial size of both groups was set to 100%, the post-treatment size of the Sham was 13.80 ± 20.29% and that of the LED was 3.52 ± 6.68%. The change in wound size from pre-treatment to post-treatment was significant in both groups (Sham, p < 0.001, and LED, p = 0.001), but there was no significant difference between the two groups ( p = 0.070). There were 11 experimental wounds (LED) and 3 control wounds (Sham) in deepest level. At screening (visit 2), the mean size (length × width) of the wounds in the Sham was 3.91 ± 3.24 cm 2 , but the mean size of the wounds in the LED was 11.35 ± 17.01 cm 2 . Following 12 LED treatments (visit 14), the Sham measured 0.48 ± 0.49 cm 2 , while the LED measured 6.51 ± 9.46 cm 2 . When the initial size of both groups was set to 100%, the post-treatment sizes of the Sham and B were 8.12 ± 8.06% and 59.77 ± 28.18%, respectively. The LED demonstrated a significant difference between the change in wound size before and after treatment ( p = 0.003), whereas the Sham did not ( p = 0.109). This may be due to the small number of wounds in the Sham, which made obtaining statistically significant results challenging. In addition, there was no statistically significant difference in treatment outcomes between the two groups ( p = 0.148).

https://doi.org/10.1371/journal.pone.0305616.s004

S3 Fig. Microscope images of epidermal regeneration using Hematoxylin and Eosin (H&E) staining between two groups.

(A) The thickness of the epidermis was calculated as the mean of the shortest, longest, and middle sites. (B) Microscopic images of basement membrane lengthening (red line).

https://doi.org/10.1371/journal.pone.0305616.s005

S4 Fig. Microscopic images of collagen deposition with blue color in MT staining between two groups.

Quantification of the collagen fibers was counted with the software of Image J as red density.

https://doi.org/10.1371/journal.pone.0305616.s006

S5 Fig. Relative mRNA expression of pro- and anti-inflammatory cytokines using Quantitative real time polymerase chain reaction (qRT-PCR) according to with and without eschar.

V, visit; n, numbers; IL, interleukin. (A) Without eschar. (B) With eschar. Interestingly, both IL-6 and IL-10 tended to increase after treatment in the classification without eschar, where LED treatment effects were deemed to be relatively high.

https://doi.org/10.1371/journal.pone.0305616.s007

S6 Fig. Protein expression of pro- and anti-inflammatory cytokines using immunohistochemistry.

Stained sections were viewed with a microscope as brown color, and the processed images were analyzed for using Image J which converted to the red density.

https://doi.org/10.1371/journal.pone.0305616.s008

S1 File. CONSORT checklist.

https://doi.org/10.1371/journal.pone.0305616.s009

S2 File. Institutional review board approval certification.

https://doi.org/10.1371/journal.pone.0305616.s010

S3 File. Institutional review board approval protocol 1 (Korean).

https://doi.org/10.1371/journal.pone.0305616.s011

S4 File. Institutional review board approval protocol 1 (English).

https://doi.org/10.1371/journal.pone.0305616.s012

S5 File. Institutional review board approval protocol 2 (Korean).

https://doi.org/10.1371/journal.pone.0305616.s013

S6 File. Institutional review board approval protocol 2 (English).

https://doi.org/10.1371/journal.pone.0305616.s014

S7 File. Institutional review board initial notice (Korean).

https://doi.org/10.1371/journal.pone.0305616.s015

S8 File. Institutional review board initial notice (English).

https://doi.org/10.1371/journal.pone.0305616.s016

S9 File. Institutional review board interim notice (Korean).

https://doi.org/10.1371/journal.pone.0305616.s017

S10 File. Institutional review board interim notice (English).

https://doi.org/10.1371/journal.pone.0305616.s018

S11 File. Institutional review board exit notice (Korean).

https://doi.org/10.1371/journal.pone.0305616.s019

S12 File. Institutional review board exit notice (English).

https://doi.org/10.1371/journal.pone.0305616.s020

S13 File. Korea Ministry of Food and Drug Safety approval certification 1 (Korean).

https://doi.org/10.1371/journal.pone.0305616.s021

S14 File. Korea Ministry of Food and Drug Safety approval certification 1 (English).

https://doi.org/10.1371/journal.pone.0305616.s022

S15 File. Korea Ministry of Food and Drug Safety approval certification 2 (Korean).

https://doi.org/10.1371/journal.pone.0305616.s023

S16 File. Korea Ministry of Food and Drug Safety approval certification 2 (English).

https://doi.org/10.1371/journal.pone.0305616.s024

Acknowledgments

All monitoring and statistical analysis was performed at KH Medicare Inc. And we are grateful to Ms. Jiah Park, an accomplished art design professional, for creating the hypothesis illustration ( Fig 9 ) for this study.

View Article
Google Scholar
PubMed/NCBI

IMAGES

Peer Pressure
PPT
On Peer Pressure and Conformity I Oxford Open Learning
Solomon Asch's Experiment about Conformity
Asch's Conformity Experiment
(PDF) A peer pressure experiment: Recreation of the Asch conformity

COMMENTS

Solomon Asch Conformity Line Experiment Study
The Asch paradigm was a series of conformity experiments by Solomon Asch designed to investigate how social pressure from a majority group could influence an individual to conform. In the experiments, groups of participants were asked to match the length of lines on cards, a task with an obvious answer. However, each group only included one ...
The Asch Line Study (+3 Conformity Experiments)
In his famous "Line Experiment", Asch showed his subjects a picture of a vertical line followed by three lines of different lengths, one of which was obviously the same length as the first one. He then asked subjects to identify which line was the same length as the first line. Solomon Asch used 123 male college students as his subjects ...
The Asch Conformity Experiments
The Asch conformity experiments are among the most famous in psychology's history and have inspired a wealth of additional research on conformity and group behavior. This research has provided important insight into how, why, and when people conform and the effects of social pressure on behavior. ... including peer-reviewed studies, to support ...
Asch conformity experiments
The Asch conformity experiments are often interpreted as evidence for the power of conformity and normative social influence, [18] [19] [20] ... Peer pressure - Influencing peers to conform; Social influence - Alteration of attitudes and behaviors based on outside influences;
Asch Conformity Experiments: Line Study
The Asch conformity experiment took place during the 1950s and examine whether people would conform to social influence on a simple line task. Learn more. ... from understanding peer pressure and decision-making in groups to exploring the dynamics of social behavior in various cultural and political contexts.
Asch Experiment
A series of studies conducted in the 1950's. The Asch Experiment, by Solomon Asch, was a famous experiment designed to test how peer pressure to conform would influence the judgment and individuality of a test subject. The experiment is related closely to the Stanford Prison and Milgram Experiments, in that it tries to show how perfectly normal ...
The Asch Conformity Experiments and Social Pressure
The Asch Conformity Experiments. What Solomon Asch Demonstrated About Social Pressure. The Asch Conformity Experiments, conducted by psychologist Solomon Asch in the 1950s, demonstrated the power of conformity in groups and showed that even simple objective facts cannot withstand the distorting pressure of group influence.
The Asch Conformity Experiment and Its Implications
The Asch Conformity Experiment and Its Implications. Social Psychology is a field of psychology that aims to study the behaviour of human beings in a social context. It examines how our behaviour, ideas, feelings, and emotions are affected by the presence of others in an environment. Group behaviour, peer pressure, interpersonal relations ...
Solomon Asch Theory
Asch's research on conformity demonstrated the powerful influence of social factors, particularly peer pressure, on our perception of the world. Participants in Asch's experiments often conformed to the group's incorrect judgments, illustrating the impact of social influence on individual behavior.
Elevator Groupthink: An Ingenious 1962 Psychology Experiment in Conformity
Among them is this famous elevator experiment, originally conducted as a part of a 1962 Candid Camera episode titled "Face the Rear.". But, while amusing in its tragicomic divulgence of our capacity for groupthink, this experiment tells only half the story of Asch's work. As James Surowiecki reminds us in the excellent The Wisdom of ...
Conformity
Share : Asch (1951) conducted one of the most famous laboratory experiments examining conformity. He wanted to examine the extent to which social pressure from a majority, could affect a person to conform. Asch's sample consisted of 50 male students from Swarthmore College in America, who believed they were taking part in a vision test.
The power of social influence: A replication and extension of the Asch
Fujita and Mori compared group reward and individual rewards in the Asch experiment and found that conformity vanished in the individual reward condition. Thus, the existing evidence on the role of incentives is inconclusive, calling for further investigations of the effect of incentives. ... Conformity to peer pressure in preschool children ...
Asch Conformity Experiment
Classic footage from the Asch conformity study. This version includes definitions of normative and informational conformity and the powerful effect of having...
A peer pressure experiment: Recreation of the Asch conformity
The question put forward in this paper is whether robots can create conformity by means of group pressure. We recreate and expand on a classic social psychology experiment by Solomon Asch, so as to explore three main dimensions. First, we wanted to know whether robots can prompt conformity in human subjects, and whether there is a significant difference between the degree to which individuals ...
Social Conformity and Group Pressure
Solomon Asch is considered the pioneer of experiments related to the impact of social pressure on conformity. The extent of conformity has been found to be influenced by factors like culture ...
A peer pressure experiment: Recreation of the Asch conformity
The question put forward in this paper is whether robots can create conformity by means of group pressure. We recreate and expand on a classic social psychology experiment by Solomon Asch, so as ...
Asch's Conformity Experiment on Groupthink
In the 1950s the psychologist Solomon Asch devised a study to investigate whether peer pressure can be strong enough to change our perception, and make us be...
Solomon Asch Biography: The Man Behind the Conformity Experiments
Solomon Asch was a pioneering 20th century social psychologist who is perhaps best remembered for his research on the psychology of conformity. Asch took a Gestalt approach to the study of social behavior, suggesting that social acts needed to be viewed in terms of their setting. His famous conformity experiment demonstrated that people would change their response due to social pressure in ...
What Is Conformity? Definition, Types, Psychology Research
Non Conformity. Conformity is a type of social influence involving a change in belief or behavior in order to fit in with a group. This change is in response to real (involving the physical presence of others) or imagined (involving the pressure of social norms/expectations) group pressure. Conformity can also be simply defined as " yielding ...
PDF A Peer Pressure Experiment: Recreation of the Asch Conformity
A second experiment is reported by Solomon Asch in his influential paper "Effects of group pressure upon the mod-ification and distortion of judgements". Asch builds on the findings of Sherif ...
Children conform, adults resist: A robot group induced peer pressure on
Participants in the human-peer and robot-peer conditions were informed of the role of the confederates and what the aim of the experiment was: the measuring of normative social conformity. They were also given a questionnaire to collect demographic details, data on familiarity with and views of robots, and a personality test.
Understanding Peer Pressure and Teenage Stress
Peer pressure, broadly defined, is the influence exerted by a peer group that encourages individuals to change their attitudes, values, or behaviors to conform to the group's norms. During the teenage years, this influence becomes particularly potent as adolescents seek acceptance and validation from their peers.
Generation of out-of-plane polarized spin current by non ...
The free-field switching of the perpendicular magnetization by the out-of-plane polarized spin current induced spin-orbit torque makes it a promising technology for developing high-density memory ...
The significance of electrical signals in maturing spermatozoa for
The experiment group in caput epididymis (e) corresponds to the experiment group of "low K + " shown in Supplementary Fig. 4. For ( c - f ), n = 5,5,5 and 6 biologically independent mice in ...
The validity and safety of multispectral light emitting diode (LED
Purpose The management of pressure ulcers (PUs) poses challenges due to their chronic nature and the lack of established conservative treatment methods. In this clinical trial, our objective was to examine the validity and safety of using a light-emitting diode device contained four wavelengths in the treatment of grade 2 sacral PUs. Method A total of 38 patients were randomly assigned to two ...

The Asch Line Study (+3 Conformity Experiments)

How Did the Asch Line Study Work?

Who was Solomon Asch?

Findings of Asch's Conformity Study

Interviewing the Participants

Conclusions from the Asch Line Study

Asch Line Study vs. Milgram Experiment

Further Experiments and Variations

Why Is The Asch Line Study Ethnocentric? And Other Criticisms

Experimenter Bias in the Asch Line Study

Further Criticisms of the Asch Line Study

Related posts:

About The Author

Psychology Resources

Psychology Tests

Asch Conformity Experiments: Line Study

The Asch Experiments

Results of the Asch Conformity Experiments

Explanations for the Results

Normative Social Influence

Informational Social Influence

Other Factors That Can Influence Conformity

Critiques of the Asch Conformity Experiments

Impact and Contributions of the Asch Conformity Experiments

Search form

Asch Experiment

This article is a part of the guide:

Browse Full Outline

You Are Allowed To Copy The Text

Want to stay up to date? Follow us!

Footer bottom

The Asch Conformity Experiments

The Experiment

Connection to Sociology

Your cart is empty

The Asch Conformity Experiment and Its Implications

The Asch Conformity Experiment

Experiment Design

Experiment Procedure

Results and Analysis

Implications of the Experiment

Social Media Influence

Education and Peer Pressure

Household Conformity and Obedience

Share This Post:

Related Post

Cultivating a Compassionate Classroom

Behind the Mask: The Impact of Anonymity and

To be a Polyglot: How it affects Cognitive

10 Things You Didn’t Know About Psychology Before

Precognitive Dreams: Glimpses of What’s to Come

Solomon Asch Theory

Who was Solomon Asch?

Solomon Asch's Family Life

Asch's Education and Early Career Moves

Asch's Conformity Experiments

Notable Solomon Asch Experiments

The Asch Paradigm: Understanding Peer Pressure

Asch's Legacy in Social Psychology

Asch's Influence on Group Dynamics Research

The Psychology of Compliance

Further Reading on Solomon Asch's Theories

Enhance Learner Outcomes Across Your School

We'll send it over now.

What type of school are you?

Is your school involved in any staff development projects?

Do you have any immediate school priorities?

Download your resource

Elevator Groupthink: An Ingenious 1962 Psychology Experiment in Conformity

www.themarginalian.org

PRINT ARTICLE

Conformity - Asch (1951)

Evaluation of Asch

You might also like

Conformity in Action: Why Our Friends Want Us to Drink?

Conformity & Minority Influence: Example Answer Video for A Level SAM 2, Paper 1, Q3 (7 Marks)

Explanations for Conformity Application Essay: Example Answer Video for A Level SAM 3, Paper 1, Q3 (16 Marks)

The power of social influence: A replication and extension of the Asch experiment

Sebastian Mader

1. Introduction